BackgroundComminuted patellar fractures are not rare, and the ideal treatment method remains controversial. The present study was conducted to evaluate effects and compare complications of two different methods used to treat comminuted patellar fractures.MethodsFrom March 2010 to August 2016, 102 cases of 34-C2 or 34-C3 comminuted patellar fractures were treated at our hospital, wherein patients received two different treatments: titanium cable tension band with cerclage method (group A) and intrafragmentary screws with X-shaped plating technique (group B). At follow-ups, articular step-off, range of motion (ROM), Lysholm scores, time of union, and complications were recorded and analyzed. Radiographic and clinical data as well as rate of complications were statistically analyzed.ResultsIn total, 87 patients were included in the final analysis (n = 47 in group A and n = 40 in group B). No significant differences were noted in terms of cost of implant, age, gender, rate of 34-C3 fractures, rate of layered inferior pole fractures, postoperative articular step-off and union time. At 2-year follow-up, average Lysholm scores, ROM and rate of complications were (89.0 ± 4.5), (122°±12°) and (27.7%) in group A and (90.2 ± 3.9), (124°±11°) and (17.5%) in group B, respectively, with no significant differences (p > 0.05). The mean time of surgery in group B was shorter than that in group A with significant difference (p < 0.05).ConclusionsTreatment using the intrafragmentary screws and plate method for amenable comminuted patellar fractures achieved similar complication rate and favorable functional outcomes at the 2-year follow-up, which was comparable to the titanium cable tension band with cerclage method. Thus, the intrafragmentary screws and plate method is effective, safe and convenient for 34-C2/C3 comminuted patellar fractures, especially appropriate for patients with layered fragments. 相似文献
Recent epidemiological studies suggested that proton pump inhibitor (PPI) use was associated with an increased risk of biliary tract cancer (BTC), however, confounders were not adequately controlled. Our study aimed to evaluate PPI use and subsequent risk of BTC and its subtypes in three well-established cohorts. We conducted a pooled analysis of the subjects free of cancers in UK Biobank (n = 463 643), Nurses' Health Study (NHS, n = 80 235) and NHS II (n = 95 869). Propensity score weighted Cox models were used to estimate marginal HRs of PPIs use on BTC risk, accounting for potential confounders. We documented 284 BTC cases in UK Biobank (median follow-up: 7.6 years), and 91 cases in NHS and NHS II cohorts (median follow-up: 15.8 years). In UK biobank, PPI users had a 96% higher risk of BTC compared to nonusers in crude model (HR 1.96, 95% CI 1.44-2.66), but the effect was attenuated to null after adjusting for potential confounders (HR 0.95, 95% CI 0.60-1.49). PPI use was not associated with risk of BTC in the pooled analysis of three cohorts (HR 0.93, 95% CI 0.60-1.43). We also observed no associations between PPI use with risk of intrahepatic (HR 1.00, 95% CI 0.49-2.04), extrahepatic bile duct (HR 1.09, 95% CI 0.52-2.27) and gallbladder cancers (HR 0.66, 95% CI 0.26-1.66) in UK Biobank. In summary, regular use of PPIs was not associated with the risk of BTC and its subtypes. 相似文献
The research and development of penicillin started with difficulty before 1949 and achieved certain results. In 1951, after the founding of the People's Republic of China, Zhang Weishen, as the only Chinese scientist who had been trained and worked in a penicillin research and development center in the United States for many years, overcame many difficulties and returned to China. In 1953, with the efforts of Zhang Weishen and his colleagues, China realized the industrialized production of penicillin, alleviating the urgent needs of the masses. Antibiotics has also become the first discipline to achieve major scientific and technological achievements after the founding of the New China. In the mid-1950s, the technical breakthrough in the localization of lactose substitutes marked the localization of the raw materials of the penicillin-producing culture medium, which paved the way for the industrialized production of penicillin with Chinese characteristics. Antibiotics have become one of the most widely used and affordable drugs for hundreds of millions of patients in China, and China has since ended the humiliating history of the “Sick Man of East Asia". 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献