PurposeTo develop and evaluate an automated method to measure the foveal avascular zone (FAZ) area in healthy eyes on Heidelberg Spectralis Optical Coherence Tomography Angiography (HS-OCTA). This method is referred to as the modified Kanno-Saitama macro (mKSM) which is an evolution of the Kanno-Saitama macro (KSM) approach.MethodsThis cross-sectional study included 29 eyes of 25 healthy volunteers who underwent HS-OCTA at the macular area twice at the same time. Regardless of the quality of the images, all of them were included. Macular data on the superficial vascular plexus, intermediate capillary plexus (ICP) and deep capillary plexus were processed by mKSM. The FAZ area was measured twice automatically using the mKSM and KSM and twice manually by two independent examiners.ResultsFrom 174 images, KSM could not measure correctly 31% while mKSM could successfully measure all of them. Intrascan intraclass coefficient ranged from 0.948 to 0.993 for manual measurements and was 1 for mKSM method. Despite that the difference between human examiners is smaller than between human examiners and mKSM according to Bland-Altman plots, the scatterplots show a strong correlation between human and automatic measurements. The best results are obtained in ICP.ConclusionsWith mKSM, the automated determination of the FAZ area in HS-OCTA is feasible and less human-dependent. It solves the inability of KSM to measure the FAZ area in suboptimal quality images which are frequent in daily clinical practice. Therefore, the mKSM processing could contribute to our understanding of the three vascular plexuses. 相似文献
Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
Tamoxifen prevents recurrence of breast cancer and is suggested for preventive risk-reducing therapy. Tamoxifen reduces mammographic density, a proxy for therapy response, but little is known about its effects in remodelling normal breast tissue. Our study, a substudy within the double-blinded dose-determination trial KARISMA, investigated tamoxifen-specific changes in breast tissue composition and histological markers in healthy women. We included 83 healthy women randomised to 6 months daily intake of 20, 10, 5, 2.5, 1 mg of tamoxifen or placebo. The groups were combined to “no dose” (0-1 mg), “low-dose” (2.5-5 mg) or “high-dose” (10-20 mg) of tamoxifen. Ultrasound-guided biopsies were collected before and after tamoxifen exposure. In each biopsy, epithelial, stromal and adipose tissues was quantified, and expression of epithelial and stromal Ki67, oestrogen receptor (ER) and progesterone receptor (PR) analysed. Mammographic density using STRATUS was measured at baseline and end-of-tamoxifen-exposure. We found that different doses of tamoxifen reduced mammographic density and glandular-epithelial area in premenopausal women and associated with reduced epithelium and increased adipose tissue. High-dose tamoxifen also decreased epithelial ER and PR expressions in premenopausal women. Premenopausal women with the greatest reduction in proliferation also had the greatest epithelial reduction. In postmenopausal women, high-dose tamoxifen decreased the epithelial area with no measurable density decrease. Tamoxifen at both low and high doses influences breast tissue composition and expression of histological markers in the normal breast. Our findings connect epithelial proliferation with tissue remodelling in premenopausal women and provide novel insights to understanding biological mechanisms of primary prevention with tamoxifen. 相似文献
BackgroundHepatic steatosis has been described as a common finding in adults following total pancreatectomy with islet autotransplantation (TPIAT) but it is unknown if this occurs in children and adolescents.ObjectivesTo define the frequency of post-TPIAT hepatic steatosis in a sample of children and adolescents and to identify clinical predictors of incident steatosis post-TPIAT.MethodsIn this prospective study, consecutive participants at least 1-month post-TPIAT underwent a liver MRI with proton density fat fraction (PDFF) and blood draw at our pediatric academic medical center between April 2021 and January 2022. Comparison clinical pre-TPIAT liver MRI or ultrasound and insulin use and graft function data were extracted from the medical record. T-tests were used for the comparison of means across continuous variables between participants with and without post-TPIAT steatosis.ResultsA total of 20 participants (mean: 13 ± 4 years; 12 female) were evaluated. Mean liver PDFF at research MRI was 7.4 ± 6.2% (range: 2–25%). Seven participants (35%) had categorical hepatic steatosis (PDFF>5%) post-TPIAT, five of whom had pre-TPIAT steatosis, reflecting a 13% (2/15; 95% CI: 2–40%) incidence of post-TPIAT steatosis. Participant characteristics were not significantly different between subgroups with and without post-TPIAT steatosis. Mean PDFF at research MRI was not different between graft function subgroups (7.5% optimal/good vs. 7.3% marginal/failure; p = .96).ConclusionOur study shows a moderate prevalence but low incidence of hepatic steatosis in a small sample of children and adolescents post-TPIAT. This study raises questions about a causal relationship between TPIAT and hepatic steatosis. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献