In clinical and epidemiological studies, there is a growing interest in studying the heterogeneity among patients based on longitudinal characteristics to identify subtypes of the study population. Compared to clustering a single longitudinal marker, simultaneously clustering multiple longitudinal markers allow additional information to be incorporated into the clustering process, which reveals co-existing longitudinal patterns and generates deeper biological insight. In the current study, we propose a Bayesian consensus clustering (BCC) model for multivariate longitudinal data. Instead of arriving at a single overall clustering, the proposed model allows each marker to follow marker-specific local clustering and these local clusterings are aggregated to find a global (consensus) clustering. To estimate the posterior distribution of model parameters, a Gibbs sampling algorithm is proposed. We apply our proposed model to the primary biliary cirrhosis study to identify patient subtypes that may be associated with their prognosis. We also perform simulation studies to compare the clustering performance between the proposed model and existing models under several scenarios. The results demonstrate that the proposed BCC model serves as a useful tool for clustering multivariate longitudinal data. 相似文献
Collagens are the most abundant proteins in the extracellular matrix. They provide a framework to build organs and tissues and give structural support to make them resistant to mechanical load and forces. Several intra‐ and extracellular modifications are needed to make functional collagen molecules, intracellular post‐translational modifications of proline and lysine residues having key roles in this. In this article, we provide a review on the enzymes responsible for the proline and lysine modifications, that is collagen prolyl 4‐hydroxylases, 3‐hydroxylases and lysyl hydroxylases, and discuss their biological functions and involvement in diseases. 相似文献
Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
ObjectivesSurvival extrapolation for chimeric antigen receptor T-cell therapies is challenging, owing to their unique mechanistic properties that translate to complex hazard functions. Axicabtagene ciloleucel is indicated for the treatment of relapse or refractory diffuse large B-cell lymphoma after 2 or more lines of therapy based on the ZUMA-1 trial. Four data snapshots are available, with minimum follow-up of 12, 24, 36, and 48 months. This analysis explores how survival extrapolations for axicabtagene ciloleucel using ZUMA-1 data can be validated and compared.MethodsThree different parametric modeling approaches were applied: standard parametric, spline-based, and cure-based models. Models were compared using a range of metrics, across the 4 data snapshot, including visual fit, plausibility of long-term estimates, statistical goodness of fit, inspection of hazard plots, point-estimate accuracy, and conditional survival estimates.ResultsStandard and spline-based parametric extrapolations were generally incapable of fitting the ZUMA-1 data well. Cure-based models provided the best fit based on the earliest data snapshot, with extrapolations remaining consistent as data matured. At 48 months, the maximum survival overestimate was 8.3% (Gompertz mixture-cure model) versus the maximum underestimate of 33.5% (Weibull standard parametric model).ConclusionsWhere a plateau in the survival curve is clinically plausible, cure-based models may be helpful in making accurate predictions based on immature data. The ability to reliably extrapolate from maturing data may reduce delays in patient access to potentially lifesaving treatments. Additional research is required to understand how models compare in broader contexts, including different treatments and therapeutic areas. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
BackgroundAbnormalities in frontoparietal network (FPN) were observed in many neuropsychiatric diseases including substance use disorders. A growing number of studies are using dual-site-tACS with frontoparietal synchronization to engage this network. However, a computational pathway to inform and optimize parameter space for frontoparietal synchronization is still lacking. In this case study, in a group of participants with methamphetamine use disorders, we proposed a computational pathway to extract optimal electrode montage while accounting for stimulation intensity using structural and functional MRI.MethodsSixty methamphetamine users completed an fMRI drug cue-reactivity task. Four main steps were taken to define electrode montage and adjust stimulation intensity using 4x1 high-definition (HD) electrodes for a dual-site-tACS; (1) Frontal seed was defined based on the maximum electric fields (EF) predicted by simulation of HD montage over DLPFC (F3/F4 in EEG 10–10), (2) frontal seed-to-whole brain context-dependent correlation was calculated to determine connected regions to frontal seeds, (3) center of connected cluster in parietal cortex was selected as a location for placing the second set of HD electrodes to shape the informed montage, (4) individualized head models were used to determine optimal stimulation intensity considering underlying brain structure. The informed montage was compared to montages with large electrodes and classic frontoparietal HD montages (F3-P3/F4-P4) in terms of tACS-induced EF and ROI-to-ROI task-based/resting-state connectivity.ResultsCompared to the large electrodes, HD frontoparietal montages allow for a finer control of the spatial peak fields in the main nodes of the FPN at the cost of lower maximum EF (large-pad/HD: max EF[V/m] = 0.37/0.11, number of cortical sub-regions that EF exceeds 50% of the max = 77/13). For defining stimulation targets based on EF patterns, using group-level head models compared to a single standard head model results in comparable but significantly different seed locations (6.43 mm Euclidean distance between the locations of the frontal maximum EF in standard-space). As expected, significant task-based/resting-state connections were only found between frontal-parietal locations in the informed montage. Cue-induced craving score was correlated with frontoparietal connectivity only in the informed montage (r = ?0.24). Stimulation intensity in the informed montage, and not in the classic HD montage, needs 40% reduction in the parietal site to reduce the disparity in EF between stimulation sites.ConclusionThis study provides some empirical insights to montage and dose selection in dual-site-tACS using individual brain structures and functions and proposes a computational pathway to use head models and functional MRI to define (1) optimum electrode montage for targeting FPN in a context of interest (drug-cue-reactivity) and (2) proper transcranial stimulation intensity. 相似文献