Most surgical and anaesthetic mortality and morbidity occurs postoperatively, disproportionately affecting low- and middle-income countries. Various short courses have been developed to improve patient outcomes in low- and middle-income countries, but none specifically to address postoperative care and complications. We aimed to identify key features of a proposed short-course addressing this topic using a Delphi process with low- and middle-income country anaesthesia providers trained as short-course facilitators. An initial questionnaire was co-developed from literature review and exploratory workshops to include 108 potential course features. Features included content; teaching method; appropriate participants; and appropriate faculty. Over three Delphi rounds (panellists numbered 86, 64 and 35 in successive cycles), panellists indicated which features they considered most important. Responses were analysed by geographical regions: Africa, the Americas, south-east Asia and Western Pacific. Ultimately, panellists identified 60, 40 and 54 core features for the proposed course in each region, respectively. There were high levels of consensus within regions on what constituted core course content, but not between regions. All panellists preferred the small group workshop teaching method irrespective of region. All regions considered anaesthetists to be key facilitators, while all agreed that both anaesthetists and operating theatre nurses were key participants. The African and Americas regional panels recommended more multidisciplinary healthcare professionals for participant roles. Faculty from high-income countries were not considered high priority. Our study highlights variability between geographical regions as to which course features were perceived as most locally relevant, supporting regional adaptation of short-course design rather than a one-size-fits-all model. 相似文献
Forgiveness has been found one substantial element in the recovery for women survivors from intimate partner violence following the termination of the abusive relationship. To further investigate the details of forgiveness in this specific context, the present study explored the process of forgiveness using grounded theory. In-depth and semi-structured interviews were conducted with 25 Chinese women survivors of IPV. The findings suggest that forgiveness is a strength-based process including empowerment, transformation, and integration phases. In the empowerment phase, survivors obtain strength at the intrapersonal, behavioural, and interpersonal levels. In the transformation phase, survivors complete cognitive transformation for their IPV experiences and emotional transformation towards former partners. In the integration phase, survivors—now freed from the past—reflect upon and apply the changes they have undergone. Two trajectories in the process were found. One trajectory is going through stages sequentially and the other trajectory is experiencing back and forth between empowerment and transformation stages before moving into the integration stage. The study's findings broaden our knowledge of the strength-based forgiveness process that women survivors of IPV undergo during recovery. Practitioners and policymakers could develop programmes and policies that support forgiveness by holistically facilitating their recovery and empowerment like assistance in dealing with life difficulties and promoting their reconnection with social networks. To improve the transferability and validity of the findings, the forgiveness of survivors of IPV could be explored in a diverse sample (e.g., survivors with low educational background or live in the rural area). 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.