Novel Hot Spot of IS6110 Insertion in Mycobacterium tuberculosis

We describe a hot spot for the insertion of IS6110 in Mycobacterium tuberculosis located in the area of region of difference 724 (RD724). Because RD724 defines sublineage 724 of M. tuberculosis, caution must be exercised when screening for RD724, as different polymorphisms can be observed in this region.IS6110 is a genomic insertion element containing 1,361 bp that is found only in organisms of the Mycobacterium tuberculosis complex (20). Like other members of the IS3 family, IS6110 contains two partially overlapping reading frames, orfA and orfB, that encode a transposase (6) allowing the insertion of IS6110 at multiple sites. M. tuberculosis has been shown to contain between 0 and 25 copies of this element (12). The number of copies of IS6110 and the molecular weights of the DNA fragments in which the insertions are found provide a genotyping method known as IS6110-based restriction fragment length polymorphism (RFLP) that is widely used to study the transmission dynamics of M. tuberculosis (11, 19). Although IS6110 does not have a known target for insertion, it is believed that there are hot spots of IS6110 insertion in the genome (13). Hot spots are areas of the genome where IS6110 insertions have been identified in more than one isolate. Several hot spots for IS6110 insertion have been described, including the plcD region (23), IS1547 (4), the direct repeat locus (7), and PPE genes (25). The presence of these hot spots supports the contention that IS6110 is not randomly distributed in the genome. This is important, as IS6110 RFLP typing is based on the premises that IS6110 is integrated into the genome randomly and that the discriminatory power of the technique increases in proportion to the number of IS6110 copies. Therefore, ideally, IS6110 bands integrated in hot spots should be removed when calculating similarity indexes among isolates, although in practice, it is difficult to determine which bands are inserted in hot spots (13).Another source of genetic polymorphisms in M. tuberculosis is the insertion and deletion of genomic segments known as large sequence polymorphisms or regions of difference (RDs) (21). Most RDs are considered unique-event polymorphisms and have been used to define the six major lineages and several sublineages of M. tuberculosis (5). RD724 defines sublineage 724, a sublineage of the Euro-American lineage, and is characterized by a deletion (relative to H37Rv) of 1,129 bp (H37RV: 2265112 to 2266241) and by an IS6110 insertion at genomic address 2265111, in reverse orientation relative to the H37Rv sequence (14). M. tuberculosis isolates from this sublineage are common in Uganda (1). Here we report four distinct IS6110 insertion sites in the area where RD724 is located, a hot spot for IS6110 insertion not described previously.As part of the genetic analysis of M. tuberculosis isolates from a clinical trial (Tuberculosis Trials Consortium Study 28, comparing moxifloxacin versus isoniazid during the intensive phase of tuberculosis treatment) (3), we determined the presence of RDs to define the lineages and sublineages of M. tuberculosis (5). Among the 260 isolates screened for RD724, we found 5 with PCR products different in size from that expected for H37Rv and sublineage 724. These isolates are the focus of this study.Briefly, the PCR used to screen for RD724 was prepared with 1 μM forward primer RD724F (CCATGCGATTTGACTTCCGATTGA) and reverse primer RD724R (ATATACCGTGCCGCGACTTGCTCT), 0.4 mM deoxynucleoside triphosphates, 0.65 U of Taq polymerase, 1× buffer, 2.5 mM Mg²⁺, and 1× Qsol. The PCR cycle included 1 min at 96°C; 30 cycles of 40 s at 96°C, 40 s at 62°C, and 2 min at 72°C; and 1 cycle of 10 min at 72°C. The PCR product was run in a 1% agarose gel with a 1-kb ladder.Five isolates had a PCR product of 2,649 bp, larger than that expected for M. tuberculosis H37Rv (1,200 bp) and for isolates from sublineage 724 (1,521 bp) (Fig. ​(Fig.1).1). To determine the exact nature of the genetic polymorphism, we performed sequencing and blast analysis. The sequence reaction was performed using the primers described previously and internal primers RD724ipG (AATGGGAGCCGAGCGTGACTGC) and RD724ipN (AAATCAGCTTTGCCGACGAC) to bridge the polymorphism. Products were sequenced using ABI BigDye v3.1 dye terminator sequencing chemistry and the ABI PRISM 3730xl capillary DNA analyzer (Applied Biosystems) at the UCSF Genomic Core Facility (http://genomics.ucsf.edu/). The sequence data were analyzed using ClustalW (http://www.ebi.ac.uk/Tools/clustalw/index.html), and the blast analysis was performed using TubercuList (http://genolist.pasteur.fr/TubercuList/). We also performed IS6110 RFLP and spoligotyping on the five isolates according to previously described methodology (9, 22).Open in a separate windowFIG. 1.Gel electrophoresis of PCR-amplified gene fragments of the RD724 region. PCR products were run on a 1% agarose gel with ethidium bromide and visualized with UV light. Lanes are flanked by a 1-kb ladder. Lanes: WT, H37RV (wild type, 1,288 bp); PC, positive control with RD724 deleted (1,521 bp); NC, negative control; A1, isolate 369 (polymorphism A, 2,649 bp); A2, isolate 377 (polymorphism A, 2,649 bp); B, isolate 144 (polymorphism B, 2,649 bp); C, isolate 194 (polymorphism C, 2,649 bp); D, isolate 188 (polymorphism D, 2,666 bp).The sequences of all five PCR products did not reveal the deletion (relative to H37Rv) that characterizes RD724 (Fig. ​(Fig.2).2). In all cases, there was an insertion of an IS6110 element in a forward position relative to the H37Rv genome within the boundaries of RD724. In two isolates (no. 369 and 377), all 1,361 bp of the IS6110 element were inserted at genomic address 2265111 (polymorphism A), which is the same site where the IS6110 element in RD724 is inserted. This insertion site was reported previously in reference strain MTB14323 (15). This site corresponds to the intergenic region between Rv2017 (2263998 to 2265038) and Rv2018 (2265280 to 2265999). One isolate (no. 188) had all 1,361 bp of the IS6110 plus 17 bp that correspond to the last 17 bp of the IS6110 element inserted at 2265175 (polymorphism D), also corresponding to the intergenic region between Rv2017 and Rv2018. In one isolate (no. 144), all 1,361 bp of IS6110 were inserted at 2266167 (polymorphism B), and in another isolate (no. 194), all 1,361 bp of IS6110 were inserted at 2266216 (polymorphism C). These two insertion sites are located within Rv2019 (2265989 to 2266405), a gene that codes for a hypothetical protein. The IS6110 RFLP patterns (patterns not shown; number of bands included in Table ​Table1)1) and spoligotypes (Table ​(Table1)1) were different among the five isolates, indicating that none of the five isolates were epidemiologically related. Consequently, there are at least four independent IS6110 insertion sites in the area where RD724 is located.Open in a separate windowFIG. 2.Sites of IS6110 element insertion in the region of the large sequence polymorphism RD724. The schematic shows the sequence of H37RV in the 5′→3′ orientation. The white bar indicates the intergenic region between Rv2017 and Rv2018. The insertion of IS6110 (black triangle) and genomic deletion (under bracket) characterizing RD724 are shown above the bar. Dashed arrows represent primers 724F (Rv2265026 to Rv2265049) and 724R (Rv2266314 to Rv2266291). Four distinct IS6110 insertion sites are present (denoted by white triangles with the letters referring to the different polymorphisms). Strains with polymorphism A have an insertion at 2265111, those with polymorphism D have an insertion at 2265175, those with polymorphism B have an insertion at 2266167, and those with polymorphism C have an insertion at 2266216. The solid arrows below the triangles indicate the direction of the IS6110 element relative to H37Rv. The distance between IS6110 insertion sites in polymorphisms A and D is 64 bp, that in polymorphisms D and B is 992 bp, and that in polymorphisms B and C is 49 bp.

TABLE 1.

Sublineages, IS6110 band numbers,^a and spoligotypes of the isolates with different polymorphisms in the area of RD724

Open in a separate window

Open in a separate window^aBased on IS6110 RFLP.Because our findings show that there is an IS6110 hot spot within the primers published and used to determine the presence or absence of RD724, we sequenced 63 of 102 isolates with PCR product sizes consistent with RD724 (1,521 bp) to determine the presence of additional polymorphisms. All of these isolates had the described RD724 polymorphism, indicating that the possibility of a different polymorphism in the presence of a PCR product size consistent with RD724 is unlikely.The insertion sites identified in this study were either intergenic or found in nonessential genes according to transposon mutagenesis (10, 18). This finding is consistent with the observation that insertions do not occur in essential genes (2, 16, 24, 25), such as those associated with virulence, detoxification, and adaptation, or close to the origin of replication oriC because they are deleterious to the organism. A comprehensive analysis of 161 clinical isolates of M. tuberculosis demonstrated 340 distinct IS6110 insertion sites, 294 of which were mapped on H37Rv (25). One hundred eighty (61%) were intragenic insertions affecting 100 genes, most of them nonessential genes (17, 18).Polymorphisms A, B, C, and D occurred in isolates from the Euro-American lineage that do not belong to sublineage 724. Therefore, we screened for known sublineages 115, 122, 174, 182, 183, 193, 219, and 726 of the Euro-American lineage using previously described methodology (5) and confirmed the exact base pair location of the polymorphism using sequencing as described previously. The results are shown in Table ​Table1.1. No RD was found in two isolates (and therefore these were considered H37Rv-like isolates). The other three isolates belonged to sublineages RD726, RD182, and RD115. A recent study using single nucleotide polymorphisms confirmed that RD182 and H37Rv-like are different sublineages. Unfortunately, isolates from sublineages RD726 and RD115 were not included in this study (8). Interestingly, the two isolates with polymorphism A belonged to two different sublineages (RD726 and H37Rv-like). We confirmed this information by repeating the experiments. This is in line with evidence that insertion sequences can be found at the same site in strains that do not have an ancestor in common (24).In conclusion, the genomic area comprising genes Rv2017 to Rv2019 corresponds to a hot spot for IS6110 insertion. Caution must be exercised when screening for RD724, as different polymorphisms (resulting in different PCR product sizes) that are not phylogenetically linked can be observed in this region.