IntroductionMonoclonal antibody therapy has been reported to be highly effective for preventing hospitalisation and severe cases in patients with Coronavirus Disease 2019 (COVID-19). However, since the drug is not readily available, it is important to rapidly and appropriately identify high-risk patients who can benefit most from therapy. Therefore, we designed a risk scoring system to identify at-risk COVID-19 patients in our region during the largest surge of COVID-19, from July to September 2021.MethodsAccording to the risk scores, confirmed COVID-19 patients were introduced to receive REGN-CoV-2 to our hospital by regional health centre from 18th August (Term 3). The primary outcome was the comparison of the number of hospitalisation and severe condition with other periods, the 4th wave (Term 1) and the early part of the 5th wave (Term 2) in Japan.ResultsDuring Term 3, 115 patients were stratified with the scoring system and administered REGN-COV-2. The number of hospitalisation vs severe cases were 60 (5.2%) vs 14 (1.2%), 8 (1.5%) vs 3 (0.6%) and 21 (1.2%) vs 2 (0.1%), in term 1, 2 and 3, respectively. Among those aged <60 years, compared with term 1, the relative risk of hospitalisation and severe condition were 0.25 (95% CI: 0.12–0.53) and 0.10 (95% CI: 0.01–0.80), respectively, in term 3. Drug adverse events were fever (3: 2.6%), headache (1: 0.9%) and neck rash (1: 0.9%), all events were resolved within 24 h wth no serious adverse event.ConclusionsThe administration of monoclonal antibody therapy using a risk scoring system significantly reduced the number of hospitalisation and disease severity of COVID-19 without any serious adverse events and avoided regional medical collapse. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.
