Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
ObjectiveThe objective of this study was to investigate the association between morphological variation and postsurgical pulmonary vein (PV) stenosis (PPVS) in patients with cardiac total anomalous pulmonary venous connection (TAPVC).MethodsThis single-center, retrospective study included 168 pediatric patients who underwent surgical repair of cardiac TAPVC from 2013 to 2019 (connection to the coronary sinus [CS], n = 136; connection directly to the right atrium [RA], n = 32). Three-dimensional computed tomography modeling and geometric analysis were performed to investigate the morphological features; their relevance to the PPVS was examined.ResultsThe connection type had no association with PPVS (CS type: 18% vs right atrial type: 19%; P = .89) but there was a higher incidence of PPVS in patients with a single PV orifice than > 1 orifice (P < .001). Confluence-to-total PV area ratio (hazard ratio, 4.78, 95% CI, 1.86-12.32; P = .001) and length of drainage route (hazard ratio, 1.22; 95% CI, 1.14-1.31; P < .001) had a 4- and 1-fold increase in the risk for PPVS in the CS type after adjustment for age and preoperative pulmonary venous obstruction. In the right atrial type, those with anomalous PV return to the RA roof were more likely to develop PPVS than to the posterior wall of the RA (P < .001).ConclusionsThe number of inter-junction PV orifice correlated with PPVS development in cardiac TAPVC. The confluence-to-total PV ratio, length of drainage route, and anomalous PV return to the RA roof are important predictors for PPVS. Morphological subcategorization in this clinical setting can potentially assist in surgical decision-making. 相似文献
ObjectivesThe aim of this study was to report 1-year clinical outcomes following commercial transcatheter left atrial appendage occlusion (LAAO) in the United States.BackgroundThe National Cardiovascular Data Registry LAAO Registry was initiated to meet a condition of Medicare coverage and allow the assessment of clinical outcomes. The 1-year rates of thromboembolic events after transcatheter LAAO in such a large cohort of “real-world” patients have not been previously reported.MethodsPatients entered into the National Cardiovascular Data Registry LAAO Registry for a Watchman procedure between January 1, 2016, and December 31, 2018, were included. The primary endpoint was ischemic stroke. Key secondary endpoints included the rate of ischemic stroke or systemic embolism, mortality, and major bleeding. Major bleeding was defined as any bleeding requiring hospitalization, and/or causing a decrease in hemoglobin level > 2g/dL, and/or requiring blood transfusion that was not hemorrhagic stroke. The Kaplan-Meier method was used for 1-year estimates of cumulative event rates.ResultsThe study population consisted of 36,681 patients. The mean age was 76.0 ± 8.1 years, the mean CHA2DS2-VASc score was 4.8 ± 1.5, and the mean HAS-BLED score was 3.0 ± 1.1. Prior stroke was present in 25.5%, clinically relevant bleeding in 69.5%, and intracranial bleeding in 11.9%. Median follow-up was 374 days (IQR: 212-425 days). The Kaplan-Meier–estimated 1-year rate of ischemic stroke was 1.53% (95% CI: 1.39%-1.69%), the rate of ischemic stroke or systemic embolism was 2.19% (95% CI: 2.01%-2.38%), and the rate of mortality was 8.52% (95% CI: 8.19%-8.87%). The 1-year estimated rate of major bleeding was 6.93% (95% CI: 6.65%-7.21%). Most bleeding events occurred between discharge and 45 days following the procedure.ConclusionsThis study characterizes important outcomes in a national cohort of patients undergoing transcatheter LAAO in the United States. Clinicians and patients can integrate these data in shared decision making when considering this therapy. 相似文献