PurposeAccording to the social determinants of health framework, income inequality is a potential risk factor for adverse mental health. However, few studies have explored the mechanisms suspected to mediate this relationship. The current study addresses this gap through a mediation analysis to determine if social support and community engagement act as mediators linking neighbourhood income inequality to maternal anxiety and depressive symptoms within a cohort of new mothers living in the City of Calgary, Canada.MethodsData collected at three years postpartum from mothers belonging to the All Our Families (AOF) cohort were used in the current study. Maternal data were collected between 2012 and 2015 and linked to neighbourhood socioeconomic data from the 2006 Canadian Census. Income inequality was measured using Gini coefficients derived from 2006 after-tax census data. Generalized structural equation models were used to quantify the associations between income inequality and mental health symptoms, and to assess the potential direct and indirect mediating effects of maternal social support and community engagement.ResultsIncome inequality was not significantly associated with higher depressive symptoms (β = 0.32, 95%CI = −0.067, 0.70), anxiety symptoms (β = 0.11, 95%CI = −0.39, 0.60), or lower social support. Income inequality was not associated with community engagement. For the depression models, higher social support was significantly associated with lower depressive symptoms (β = −0.13, 95%CI = −0.15, −0.097), while community engagement was not significantly associated with depressive symptoms (β = 0.059, 95%CI = −0.15, 0.27). Similarly, for the anxiety models, lower anxiety symptoms were significantly associated with higher levels of social support (β = −0.17, 95%CI = −0.20, −0.13) but not with higher levels of community engagement (β = 0.14, 95%CI = −0.14, 0.41).ConclusionThe current study did not find clear evidence for social support or community engagement mediating the relationship between neighbourhood income inequality and maternal mental health. Future investigations should employ a broader longitudinal approach to capture changes in income inequality, potential mediators, and mental health symptomatology over time. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.
