IntroductionDetailed data on clinical characteristics in children with the omicron strain of SARS-COV-2 are limited.MethodsWe conducted a retrospective observational study of children with COVID-19 at the National Center for Child Health and Development to evaluate the clinical manifestations during and before the emergence of the omicron variant. Only symptomatic patients without underlying diseases were included. Participants were divided into two temporal groups: the “omicron era” (1/2022–2/2022) and the “pre-omicron era,” where the delta variant predominated (7/2021–11/2021). The patients were subclassified into an older vaccine-eligible group (aged 12–17 years), a younger vaccine-eligible group (aged 5–11 years), and a vaccine-ineligible group (aged 0–4 years).ResultsWe compared 113 patients in the omicron era with 106 in the pre-omicron era. Most patients in both eras had non-severe disease, and no patients required mechanical ventilation or died. Among patients aged 0–4 years, sore throat and hoarseness were more common during the omicron era than the pre-omicron era (11.1% vs. 0.0% and 11.1% vs. 1.5%, respectively). Croup syndrome was diagnosed in all patients with hoarseness. Among patients aged 5–11 years, vomiting was more frequent during the omicron era (47.2%) than during the pre-omicron era (21.7%). Cough and rhinorrhea were less common during the omicron era in patients aged 0–4 and 5–11 years, respectively, than during the pre-omicron era.ConclusionsIn children with COVID-19, clinical manifestations differed between the omicron and pre-omicron eras. In the Omicron era, croup syndrome was more frequent in vaccine-ineligible children. 相似文献
Objective: Animal environments for the growth of stem cells cause the transmission of some diseases and immune problems for the recipient. Accordingly, replacing these environments with healthy environments, at least with human resources, is essential. One of the media that can be used as an alternative to animal serums is Wharton acellular jelly (AWJ). Therefore, in this study, we intend to replace FBS with Wharton jelly and investigate its effect on the expression of megakaryocyte-related genes and markers in stem cells. Materials and Methods: In this study, cord blood-derived CD34 positive HSCs were cultured and expanded in the presence of cytokines including SCF, TPO, and FLT3-L. Then, the culture of expanded CD34 positive HSCs was performed in two groups: 1) IMDM culture medium containing 10% FBS and 100 ng / ml thrombopoietin cytokine 2) IMDM culture medium containing 10% AWJ, 100 ng / ml thrombopoietin cytokine. Finally, CD41 expressing cells were analyzed with the flow cytometry method. The genes related to megakaryocyte lineage including FLI1 and GATA2 were also evaluated using the RT-PCR technique. Results: The expression of CD41, a specific marker of megakaryocyte lineage in culture medium containing Wharton acellular jelly was increased compared to the FBS group. Additionally, the expression of GATA2 and FLI1 genes was significantly increased related to the control group. Conclusion: This study provided evidence of differentiation of CD34 positive hematopoietic stem cells from umbilical cord blood to megakaryocytes in a culture medium containing AWJ. 相似文献
BackgroundEpidermolysis bullosa (EB) is a genodermatosis characterized by skin fragility and blisters with variable severity. Patients with Dystrophic EB (DEB) or Junctional EB (JEB) mainly present to clinic due to greater functional impairment. Pathogenic sequence variations in COL7A1 are implicated in DEB.ObjectiveWe have tried to decipher the molecular spectrum and genotype phenotype correlation of 21 Indian patients with EB.MethodsNext generation sequencing (NGS) was performed to determine the pathogenic variants. Sanger sequencing was also done for validation of the variants in eleven individuals.ResultsPathogenic variants were detected in 20 individuals (diagnostic yield of 95%). Majority of them (90%) had sequence variation in COL7A1 while two had pathogenic variants in ITGB4 and KRT14 respectively. Out of the 18 patients confirmed to have DEB, 3 had Dominant DEB (DDEB) whereas 15 patients had Recessive DEB (RDEB). Amongst 23 sequence variations identified, 12 were found to be novel (3 were missense, 5 were premature termination codon variants while 4 were splice-site changes).ConclusionGenotype phenotype correlation was noted with milder manifestations in those with dominant inheritance types. Exact molecular diagnosis can be ascertained by NGS in majority of cases. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.