Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Anomalous origin of the left coronary artery from the pulmonary artery (ALCAPA) is a rare congenital condition. It responds well to early diagnosis and treatment, but otherwise the prognosis is poor. We present our case series of 12 patients (mean age, 2 ± 2.58 yr; age range, 2 mo–8 yr), emphasizing the diagnostic process and discussing our surgical results. The diagnosis of ALCAPA should be suspected in infants who have dilated cardiomyopathy with electrocardiographic changes that suggest ischemia, and in older children who have isolated mitral regurgitation. When clinical suspicion is high, the results of 2-dimensional echocardiography combined with color-flow Doppler studies in expert hands can establish the diagnosis, thus avoiding angiography in critically ill infants. The treatment of choice in our patients was transfer and reimplantation of the left coronary artery onto the ascending aorta. There were 2 deaths: both were infants in extremis who underwent emergency surgery. An older child with severe ventricular dysfunction was given mechanical ventricular assistance and then heart transplantation. As of this report, all 10 survivors remained well and asymptomatic. 相似文献
A pulmonary artery (PA) sling is a very rare congenital cardiovascular anomaly, and only a few studies have reported PA slings in fetuses. The relationship of the PA, aorta, ductus arteriosus, and trachea can be evaluated in the 3‐vessel and 3‐vessel and trachea views during fetal echocardiography. A PA sling can be detected by abnormal positioning of the left PA in relation to the trachea when sweeping from the 3‐vessel view cranially to the 3‐vessel and trachea view. Here we report 3 cases of fetal PA slings and their follow‐ups. Two cases were confirmed by postnatal echocardiography, and the other case was confirmed by a cardiovascular cast after pregnancy termination. We emphasize that the 3‐vessel and 3‐vessel and trachea views are of crucial importance in the prenatal diagnosis of a PA sling. 相似文献