Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
PurposeThe long-term success of visual rehabilitation in patients with severe conjunctival scarring is reliant on the reconstruction of the conjunctiva with a suitable substitute. The purpose of this study is the development and investigation of a re-epithelialized conjunctival substitute based on porcine decellularized conjunctiva (PDC).MethodsPDC was re-epithelialized either with pre-expanded human conjunctival epithelial cells (PDC + HCEC) or with a human conjunctival explant placed directly on PDC (PDC + HCEx). Histology and immunohistochemistry were performed to evaluate epithelial thickness, proliferation (Ki67), apoptosis (Caspase 3), goblet cells (MUC5AC), and progenitor cells (CK15, ΔNp63, ABCG2). The superior construct (PDC + HCEx) was transplanted into a conjunctival defect of a rabbit (n = 6). Lissamine green staining verified the epithelialization in vivo. Orbital tissue was exenterated on day 10 and processed for histological and immunohistochemical analysis to examine the engrafted PDC + HCEx. A human-specific antibody was used to detect the transplanted cells.ResultsFrom day-14 in vitro onward, a significantly thicker epithelium and greater number of cells expressing Ki67, CK15, ΔNp63, and ABCG2 were noted for PDC + HCEx versus PDC + HCEC. MUC5AC-positive cells were found only in PDC + HCEx. The PDC + HCEx-grafted rabbit conjunctivas were lissamine-negative during the evaluation period, indicating epithelial integrity. Engrafted PDC + HCEx showed preserved progenitor cell properties and an increased number of goblet cells comparable to those of native conjunctiva.ConclusionPlacing and culturing a human conjunctival explant directly on PDC (PDC + HCEx) enables the generation of a stable, stratified, goblet cell-rich construct that could provide a promising alternative conjunctival substitute for patients with extensive conjunctival stem and goblet cell loss. 相似文献
BACKGROUND: Common clinical forms of oral lichen planus (OLP) and oral lichenoid reactions (OLR) are erythematous (ERY) or reticular (RET). The purpose of this study was to find histopathological changes that differ between these forms. METHODS: Epithelial thickness, epithelial proliferation rate, apoptosis, and HLA-DR expression were compared among 10 reticular and 12 erythematous lesions, and 11 normal oral mucosa samples (NOM). RESULTS: The epithelium in ERY was thinner than in NOM, whereas RET showed values between ERY and NOM. Cell proliferation increased significantly in ERY as compared with RET and NOM, with no difference between RET and NOM. Relative numbers of epithelial cell nuclei displaying visible chromatin condensation were reduced in ERY form. CONCLUSIONS: The markedly increased cell proliferation in ERY supports the notion that this form displays a higher disease activity as compared to RET. It can therefore be important to study each disease form separately. 相似文献