Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
Bortezomib is a novel proteasome inhibitor, which has been successfully used to treat mantle cell lymphoma and multiple myeloma. However, the direct effects of bortezomib on acute promyelocytic leukaemia (APL) have not been fully investigated. In the present study, the WST-8 assay, western blotting, flow cytometry, monodansylcadaverine staining and transmission electron microscopy were performed. It was demonstrated that bortezomib treatment induced a time- and dose-dependent decrease in the viability of NB4 cells. Bortezomib treatment induced cell apoptosis in NB4 cells, as assessed by Annexin V/propidium iodide analysis, and the detection of cleaved caspase-3, cleaved poly(ADP-ribose) polymerase, Bax and Bcl-2 expression. Furthermore, bortezomib treatment induced autophagy in NB4 cells, as indicated by autophagosome formation, p62 degradation, LC3-I to LC3-II conversion and formation of acidic autophagic vacuoles. Notably, autophagy induced by bortezomib was initiated prior to apoptosis. Inhibition of autophagy by knocking down Beclin-1 expression increased bortezomib-induced apoptosis in NB4 cells. Therefore, the present study revealed that the combination of bortezomib and autophagy inhibition may be a potential treatment strategy for APL. 相似文献
Acute diarrhea is a condition of increased water stool content, stool volume, and number of bowel movements that lasts less than 14 days. Mild diarrhea is usually self-limiting; however, undertreated moderate to severe diarrhea may cause severe dehydration and lead to hypovolemic shock. In order to prevent severe dehydration and treat patients appropriately, it is crucial for health care providers to determine the right diagnosis of patients with acute diarrhea. This article focuses on pathophysiology, general patient presentation, diagnostic tests and differential diagnosis lists of acute diarrhea to discuss which diagnosis should be made based on patient presentation and objective data. 相似文献
Hyperglycaemia is common in patients with acute brain injury admitted to an intensive care unit (ICU). Many studies have found associations between development of hyperglycaemia and increased mortality in hospitalised patients. However, the optimal target for blood glucose control is unknown. We want to conduct a systematic review with meta-analysis and trial sequential analysis to explore the beneficial and harmful effects of restrictive versus liberal glucose control on patient outcomes in adults with severe acute brain injury.
Methods
We will systematically search medical databases including CENTRAL, Embase, MEDLINE and trial registries. We will search the following websites for ongoing or unpublished trials: http://www.controlled-trials.com/ , http://www.clinicaltrials.gov/ , www.eudraCT.com , http://centerwatch.com/ , The Cochrane Library's CENTRAL, PubMed, EMBASE, Science Citation Index Expanded and CINAHL. Two authors will independently review and select trials and extract data. We will include randomised trials comparing levels of glucose control in our analyses and observational studies will be included to address potential harms. The primary outcomes are defined as all-cause mortality, functional outcome and health-related quality of life. Secondary outcomes include serious adverse events including hypoglycaemia, length of ICU stay and duration of mechanical ventilation, and explorative outcomes including intracranial pressure and infection. Trial Sequential Analysis will be used to investigate the risk of type I error due to repetitive testing and to further explore imprecision. Quality of trials will be evaluated using the Cochrane Risk of Bias tool, and quality of evidence will be assessed using the Grading of Recommendations, Assessment, Development and Evaluations (GRADE) approach.
Discussion
The results of the systematic review will be disseminated through peer-reviewed publication. With the review, we hope to inform future randomised clinical trials and improve clinical practice. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献