Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Congenital diarrhea and enteropathies (CODEs) are a group of monogenic disorders that often present with severe diarrhea in the first weeks of life. Enteric anendocrinosis (EA), an extremely rare cause of CODE, is characterized by a marked reduction of intestinal enteroendocrine cells (EC). EA is associated with recessively inherited variants in Neurogenin-3 (NEUROG3) gene. Here we investigate a case of a male infant who presented with mysterious severe malabsorptive diarrhea since birth. Thorough clinical assessments and laboratory tests were successful to exclude the majority of differential diagnosis categories. However, the patient's diagnosis was not established until the genetic test using whole-exome sequencing (WES) was performed. We identified a novel homozygous missense disease-causing variant (DCV) in NEUROG3 (c.413C>G, p.Thr138Arg). Moreover, molecular dynamic simulation analysis showed that (p.Thr138Arg) led to a global change of the NEUROG3 orientation affecting its DNA binding capacity. To the best of our knowledge, this is the first time to apply WES to reach a differential diagnosis of patients with CODEs. Our study not only expands our knowledge about NEUROG3 variants and their clinical consequences but also proves that WES is a very effective tool for the diagnosis of CODEs. This might be of value in early diagnosis of diseases and prenatal CODEs detection. 相似文献
This article was designed to provide a pediatric cardiac computed tomography angiography (CCTA) expert panel consensus based on opinions of experts of the Société Française d’Imagerie Cardiaque et Vasculaire diagnostique et interventionnelle (SFICV) and of the Filiale de Cardiologie Pédiatrique Congénitale (FCPC). This expert panel consensus includes recommendations for indications, patient preparation, CTA radiation dose reduction techniques, and post-processing techniques. The consensus was based on data from available literature (original papers, reviews and guidelines) and on opinions of a group of specialists with extensive experience in the use of CT imaging in congenital heart disease. In order to reach high potential and avoid pitfalls, CCTA in children with congenital heart disease requires training and experience. Moreover, pediatric cardiac CCTA protocols should be standardized to acquire optimal images in this population with the lowest radiation dose possible to prevent unnecessary radiation exposure. We also provided a suggested structured report and a list of acquisition protocols and technical parameters in relation to specific vendors. 相似文献