ObjectiveEach pulmonary segment is an anatomical and functional unit. However, it is fundamentally difficult to precisely distinguish every pulmonary segment using the conventional pulmonary intersegmental planes from computed tomography images. Building arteriopulmonary segments is likely to be an effective way to identify pulmonary segments.MethodsThe thoracic computed tomography images of 40 patients were collected. The anatomic structures of interest were extracted in the transverse, sagittal, and coronal planes using the semi-automated segmentation tools provided by Amira software. The intrapulmonary vessels were subsequently segmented and reconstructed. The distributions of the pulmonary arteries, veins, and bronchi were observed. In patients with pulmonary masses, the mass was also reconstructed.ResultsThe three-dimensional reconstructed images showed the branches of the pulmonary artery ramified up to their eighth order covering the entire lung as well as evident intersegmental gaps without pulmonary arteries. The segmental artery was closely accompanied by the segmental bronchi in 486 pulmonary segments (90% of total number of segments). The size and spatial location of the pulmonary mass within a pulmonary segment were also clearly visible.ConclusionsDemarcation of arteriopulmonary segments can be used to precisely distinguish every pulmonary segment and provide its detailed anatomical structure before pulmonary segmentectomy. 相似文献
Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
PurposeTo investigate the safety and efficacy of thyroid artery embolization (TAE) in the treatment of nodular goiter (NG).MethodsDuring a 5.5-year period, 56 consecutive patients with a NG underwent TAE. In Group A, there were 20 patients with a solitary/dominant 5–11-cm nodule, and in Group B, there were 36 patients with numerous nodules. Of the 56 patients, 47 (84%) had a retrosternal goiter and 25 had hyperthyroidism. In all patients, clinical and radiological evaluations were made at baseline and 6 months after TAE, and these parameters were statistically compared.ResultsIn 56 patients, 145 of the 146 thyroid arteries were successfully embolized. The 30-day mortality rate was 1.8%. Minor and major complications occurred in 25 and 2 patients, respectively. Six months after the TAE, the mean nodule volume was reduced from 80.2 mL to 25.0 mL, the mean thyroid volume was reduced from 147.0 mL to 62.6 mL, and the mean intrathoracic extension was reduced from 31.7 mm to 15.9 mm (P < .001). Of the 22 patients with non–Graves hyperthyroidism, 19 (86%) became euthyroid. The mean thyroid-related patient-reported outcome scores improved from 155.4 to 70.4 (P < .001). Of the 51 patients, 50 (98%) declared that they would recommend TAE to other patients with NG.ConclusionsTAE is safe and effective for the treatment of NG, with a significant volume reduction of the nodule(s) and thyroid gland. 相似文献
PurposeTo review and to compare indirectly the outcomes of minimally invasive therapies for the treatment of lower urinary tract symptoms secondary to benign prostatic hyperplasia.Materials and MethodsA literature search via Medline and Cochrane Central databases was completed for randomized control studies published between January 2000 to April 2020 for the following therapies: Rezum, Urolift, Aquablation, and prostatic artery embolization (PAE). Data on the following variables were included: International prostate symptom score (IPSS), maximum urinary flow rate, quality of life, and postvoid residual (PVR). Standard mean differences between treatments were compared through a meta-analysis using transurethral resection of the prostate (TURP) to assess differences in treatment effect.ResultsThere was no significant difference in outcomes between therapies for IPSS at the 3, 6, and 12-month follow ups. Although outcomes for Rezum were only available out to 3 months, there were no consistently significant differences in outcomes when comparing Aquablation versus PAE versus Rezum. TURP PVR was significantly better than Urolift at 3, 6, and 12 months. No significant differences in minor or major adverse events were noted.ConclusionAlthough significant differences in outcomes were limited, Aquablation and PAE were the most durable at 12 months. PAE has been well studied on multiple randomized control trials with minimal adverse events while Aquablation has limited high quality data and has been associated with bleeding-related complications. 相似文献
ObjectiveNew-onset postoperative atrial fibrillation (POAF) after cardiac surgery is common, with rates up to 60%. POAF has been associated with early and late stroke, but its association with other cardiovascular outcomes is less known. The objective was to perform a meta-analysis of the studies reporting the association of POAF with perioperative and long-term outcomes in patients with cardiac surgery.MethodsWe performed a systematic review and a meta-analysis of studies that presented outcomes for cardiac surgery on the basis of the presence or absence of POAF. MEDLINE, EMBASE, and the Cochrane Library were assessed; 57 studies (246,340 patients) were selected. Perioperative mortality was the primary outcome. Inverse variance method and random model were performed. Leave-one-out analysis, subgroup analyses, and metaregression were conducted.ResultsPOAF was associated with perioperative mortality (odds ratio [OR], 1.92; 95% confidence interval [CI], 1.58-2.33), perioperative stroke (OR, 2.17; 95% CI, 1.90-2.49), perioperative myocardial infarction (OR, 1.28; 95% CI, 1.06-1.54), perioperative acute renal failure (OR, 2.74; 95% CI, 2.42-3.11), hospital (standardized mean difference, 0.80; 95% CI, 0.53-1.07) and intensive care unit stay (standardized mean difference, 0.55; 95% CI, 0.24-0.86), long-term mortality (incidence rate ratio [IRR], 1.54; 95% CI, 1.40-1.69), long-term stroke (IRR, 1.33; 95% CI, 1.21-1.46), and longstanding persistent atrial fibrillation (IRR, 4.73; 95% CI, 3.36-6.66).ConclusionsThe results suggest that POAF after cardiac surgery is associated with an increased occurrence of most short- and long-term cardiovascular adverse events. However, the causality of this association remains to be established. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Endovascular treatment with mechanical thrombectomy devices demonstrated high recanalization rates but functional outcome did not correlate with high rates of recanalization obtained. Patient selection prior to the endovascular treatment is very important in the final outcome of the patient. The primary aim of our study was to evaluate the prognostic value of posterior circulation Alberta Stroke Program Early CT Score (pc-ASPECTS) and Pons-Midbrain Index (PMI) scores in patients with Basilar Artery Occlusion (BAO) treated with successful angiographic recanalization after mechanical thrombectomy.
Methods
Retrospective single-center study including 18 patients between 2008 and 2013 who had acute basilar artery occlusion managed with endovascular treatment within 24 hours from symptoms onset and with successful angiographic recanalization. The patients were initially classified into two groups according to clinical outcome and mortality at 90 days. For analysis we also divided patients into groups based on pc-ASPECTS (≥8vs.< 8) and PMI (≥3vs.< 3) on non-contrast CT (NCCT) and CT Angiography Source Images (CTASI). Imaging data were correlated to clinical outcome and mortality rate.
Results
CTASI pc-ASPECTS, dichotomized at < 8 versus≥8, was associated with a favorable outcome (RR: 2.6; 95% CI: 1.3-5.2) and a reduced risk of death (RR: 6.5: 95% CI: 7.8-23.3). All patients that survived and were functionally independent had pc-ASPECTS score≥8. None of the 5 patients with CTASI pc-ASPECTS score less than 8 survived.
Conclusion
PC-ASPECTS on CTASI is helpful for predicting functional outcome after BAO recanalization with endovascular treatment. These results should be validated in a randomized controlled trial in order to decide whether or not to treat a patient with BAO. 相似文献
Expedient extubation after cardiac surgery has been associated with improved outcomes, leading to postoperative extubation frequently during overnight hours. However, recent evidence in a mixed medical-surgical intensive care unit population demonstrated worse outcomes with overnight extubation. This study investigated the impact of overnight extubation in a statewide, multicenter Society of Thoracic Surgeons database.
Methods
Records from 39,812 patients undergoing coronary artery bypass grafting or valve operations (2008-2016) and extubated within 24 hours were stratified according to extubation time between 06:00 and 18:00 (day) or between 18:00 and 6:00 (overnight). Outcomes including reintubation, mortality, and composite morbidity-mortality were evaluated using hierarchical regression models adjusted for Society of Thoracic Surgeons predictive risk scores. To further analyze extubation during the night, a subanalysis stratified patients into 3 groups: 06:00 to 18:00, 18:00 to 24:00, and 24:00 to 06:00.
Results
A total of 20,758 patients were extubated overnight (52.1%) and were slightly older (median age 66 vs 65 years, P < .001) with a longer duration of ventilation (4 vs 7 hours, P < .001). Day and overnight extubation were associated with equivalent operative mortality (1.7% vs 1.7%, P = .880), reintubation (3.7% vs 3.4%, P = .141), and composite morbidity-mortality (8.2% vs 8.0%, P = .314). After risk adjustment, overnight extubation was not associated with any difference in reintubation, mortality, or composite morbidity-mortality. On subanalysis, those extubated between 24:00 and 06:00 exhibited increased composite morbidity-mortality (odds ratio, 1.18; P = .001) but no difference in reintubation or mortality.
Conclusions
Extubation overnight was not associated with increased mortality or reintubation. These results suggest that in the appropriate clinical setting, it is safe to routinely extubate cardiac surgery patients overnight. 相似文献