A 25-year-old, emaciated man without medical treatment was found to have died suddenly at home by his mother. At autopsy, there were no injuries to his body, but significant circulatory insufficiency was observed. Electron microscopy revealed abnormal mitochondria in cells of the cardiac conduction system. The conduction system was filled with mitochondrial size abnormalities and mitochondrial cristae abnormalities. No notable abnormal findings were observed in other organs. Genetic examination of the blood revealed the mitochondrial pathogenetic variant m.3243A>G. Epileptic seizures, diabetic ketoacidosis, and hyperosmolar hyperglycemic state were unlikely to be the cause of sudden death. The cause of death was diagnosed as arrhythmia possibly induced by the failure of the cardiac conduction system due to mitochondrial disease. This is a rare case of sudden death caused by an accumulation of abnormal mitochondria in the cardiac conduction system. 相似文献
Intratumor heterogeneity is a main cause of the dismal prognosis of glioblastoma (GBM). Yet, there remains a lack of a uniform assessment of the degree of heterogeneity. With a multiscale approach, we addressed the hypothesis that intratumor heterogeneity exists on different levels comprising traditional regional analyses, but also innovative methods including computer-assisted analysis of tumor morphology combined with epigenomic data. With this aim, 157 biopsies of 37 patients with therapy-naive IDH-wildtype GBM were analyzed regarding the intratumor variance of protein expression of glial marker GFAP, microglia marker Iba1 and proliferation marker Mib1. Hematoxylin and eosin stained slides were evaluated for tumor vascularization. For the estimation of pixel intensity and nuclear profiling, automated analysis was used. Additionally, DNA methylation profiling was conducted separately for the single biopsies. Scoring systems were established to integrate several parameters into one score for the four examined modalities of heterogeneity (regional, cellular, pixel-level and epigenomic). As a result, we could show that heterogeneity was detected in all four modalities. Furthermore, for the regional, cellular and epigenomic level, we confirmed the results of earlier studies stating that a higher degree of heterogeneity is associated with poorer overall survival. To integrate all modalities into one score, we designed a predictor of longer survival, which showed a highly significant separation regarding the OS. In conclusion, multiscale intratumor heterogeneity exists in glioblastoma and its degree has an impact on overall survival. In future studies, the implementation of a broadly feasible heterogeneity index should be considered. 相似文献
SCB01A is a novel microtubule inhibitor with vascular disrupting activity.
This first‐in‐human study demonstrated SCB01A safety, pharmacokinetics, and preliminary antitumor activity.
SCB01A is safe and well tolerated in patients with advanced solid malignancies with manageable neurotoxicity.
BackgroundSCB01A, a novel microtubule inhibitor, has vascular disrupting activity.MethodsIn this phase I dose‐escalation and extension study, patients with advanced solid tumors were administered intravenous SCB01A infusions for 3 hours once every 21 days. Rapid titration and a 3 + 3 design escalated the dose from 2 mg/m2 to the maximum tolerated dose (MTD) based on dose‐limiting toxicity (DLT). SCB01A‐induced cellular neurotoxicity was evaluated in dorsal root ganglion cells. The primary endpoint was MTD. Safety, pharmacokinetics (PK), and tumor response were secondary endpoints.ResultsTreatment‐related adverse events included anemia, nausea, vomiting, fatigue, fever, and peripheral sensorimotor neuropathy. DLTs included grade 4 elevated creatine phosphokinase (CPK) in the 4 mg/m2 cohort; grade 3 gastric hemorrhage in the 6.5 mg/m2 cohort; grade 2 thromboembolic event in the 24 mg/m2 cohort; and grade 3 peripheral sensorimotor neuropathy, grade 3 elevated aspartate aminotransferase, and grade 3 hypertension in the 32 mg/m2 cohort. The MTD was 24 mg/m2, and average half‐life was ~2.5 hours. The area under the curve‐dose response relationship was linear. Nineteen subjects were stable after two cycles. The longest treatment lasted 24 cycles. SCB01A‐induced neurotoxicity was reversible in vitro.ConclusionThe MTD of SCB01A was 24 mg/m2 every 21 days; it is safe and tolerable in patients with solid tumors. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.