Non-alcoholic fatty liver disease (NAFLD) is one of the most common complications of a metabolic syndrome caused by excessive accumulation of fat in the liver. Orthosiphon stamineus also known as Orthosiphon aristatus is a medicinal plant with possible potential beneficial effects on various metabolic disorders. This study aims to investigate the in vitro inhibitory effects of O. stamineus on hepatic fat accumulation and to further use the computational systems pharmacology approach to identify the pharmacokinetic properties of the bioactive compounds of O. stamineus and to predict their molecular mechanisms against NAFLD. Methods: The effects of an ethanolic extract of O. stamineus leaves on cytotoxicity, fat accumulation and antioxidant activity were assessed using HepG2 cells. The bioactive compounds of O. stamineus were identified using LC/MS and two bioinformatics databases, namely the Traditional Chinese Medicine Integrated Database (TCMID) and the Bioinformatics Analysis Tool for the Molecular Mechanism of Traditional Chinese Medicine (BATMAN-TCM). Pathway enrichment analysis was performed on the predicted targets of the bioactive compounds to provide a systematic overview of the molecular mechanism of action, while molecular docking was used to validate the predicted targets. Results: A total of 27 bioactive compounds corresponding to 50 potential NAFLD-related targets were identified. O. stamineus exerts its anti-NAFLD effects by modulating a variety of cellular processes, including oxidative stress, mitochondrial β-oxidation, inflammatory signalling pathways, insulin signalling, and fatty acid homeostasis pathways. O. stamineus is significantly targeting many oxidative stress regulators, including JNK, mammalian target of rapamycin (mTOR), NFKB1, PPAR, and AKT1. Molecular docking analysis confirmed the expected high affinity for the potential targets, while the in vitro assay indicates the ability of O. stamineus to inhibit hepatic fat accumulation. Conclusion: Using the computational systems pharmacology approach, the potentially beneficial effect of O. stamineus in NAFLD was indicated through the combination of multiple compounds, multiple targets, and multicellular components. 相似文献
We initiated a randomized, placebo-controlled, phase 1/2 trial to evaluate the safety and immunogenicity of the S-268019-b recombinant protein vaccine, scheduled as 2 intramuscular injections given 21 days apart, in 60 randomized healthy Japanese adults. We evaluated 2 regimens of the S-910823 antigen (5 μg [n = 24] and 10 μg [n = 24]) with an oil-in-water emulsion formulation and compared against placebo (n = 12). Reactogenicity was mild in most participants. No serious adverse events were noted. For both regimens, vaccination resulted in robust IgG and neutralizing antibody production at days 36 and 50 and predominant T-helper 1-mediated immune reaction, as evident through antigen-specific polyfunctional CD4+ T-cell responses with IFN-γ, IL-2, and IL-4 production on spike protein peptides stimulation. Based on the interim analysis, the S-268019-b vaccine is safe, produces neutralizing antibodies titer comparable with that in convalescent serum from COVID-19-recovered patients. However, further evaluation of the vaccine in a large clinical trial is warranted. 相似文献
Advanced computational methodologies suggested SARS-CoV-2, nonstructural proteins ORF1AB, ORF3a, as the source of immunodominant peptides for T cell presentation. T cell immunity is long-lasting and compatible with COVID-19 pathology. Based on the supporting clinical data, nonstructural SARS-CoV-2 protein vaccines could provide global immunity against COVID-19. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Metformin, a drug for type 2 diabetes mellitus, has shown therapeutic effects for various cancers. However, it had no beneficial effects on the survival rate of human malignant mesothelioma (HMM) patients. The present study was performed to elucidate the underlying mechanism of metformin resistance in HMM cells. Glucose‐starved HMM cells had enhanced resistance to metformin, demonstrated by decreased apoptosis and autophagy and increased cell survival. These cells showed abnormalities in mitochondria, such as decreased ATP synthesis, morphological elongation, altered mitochondrial permeability transition pore and hyperpolarization of mitochondrial membrane potential (MMP). Intriguingly, Mdr1 was significantly upregulated in mitochondria but not in cell membrane. The upregulated mitochondrial Mdr1 was reversed by treatment with carbonyl cyanide m‐chlorophenyl hydrazone, an MMP depolarization inducer. Furthermore, apoptosis and autophagy were increased in multidrug resistance protein 1 knockout HMM cells cultured under glucose starvation with metformin treatment. The data suggest that mitochondrial Mdr1 plays a critical role in the chemoresistance to metformin in HMM cells, which could be a potential target for improving its therapeutic efficacy. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.