ObjectivesTo investigate the subcortical somatosensory evoked potentials (SEPs) to electrical stimulation of either muscle or cutaneous afferents.MethodsSEPs were recorded in 6 patients suffering from Parkinson’s disease (PD) who underwent electrode implantation in the pedunculopontine (PPTg) nucleus area. We compared SEPs recorded from the scalp and from the intracranial electrode contacts to electrical stimuli applied to: 1) median nerve at the wrist, 2) abductor pollicis brevis motor point, and 3) distal phalanx of the thumb. Also the high-frequency oscillations (HFOs) were analysed.ResultsAfter median nerve and pure cutaneous (distant phalanx of the thumb) stimulation, a P1-N1 complex was recorded by the intracranial lead, while the scalp electrodes recorded the short-latency far-field responses (P14 and N18). On the contrary, motor point stimulation did not evoke any low-frequency component in the PPTg traces, nor the N18 potential on the scalp. HFOs were recorded to stimulation of all modalities by the PPTg electrode contacts.ConclusionsStimulus processing within the cuneate nucleus depends on modality, since only the cutaneous input activates the complex intranuclear network possibly generating the scalp N18 potential.SignificanceOur results shed light on the subcortical processing of the somatosensory input of different modalities. 相似文献
ObjectiveA large N20 and P25 of the median nerve somatosensory evoked potential (SEP) predicts short survival in amyotrophic lateral sclerosis (ALS). We investigated whether high frequency oscillations (HFOs) over N20 are enlarged and associated with survival in ALS.MethodsA total of 145 patients with ALS and 57 healthy subjects were studied. We recorded the median nerve SEP and measured the onset-to-peak amplitude of N20 (N20o-p), and peak-to-peak amplitude between N20 and P25 (N20p-P25p). We obtained early and late HFO potentials by filtering SEP between 500 and 1 kHz, and measured the peak-to-peak amplitude. We followed up patients until endpoints (death or tracheostomy) and analyzed the relationship between SEP or HFO amplitudes and survival using a Cox analysis.ResultsPatients showed larger N20o-p, N20p-P25p, and early and late HFO amplitudes than the control values. N20p-P25p was associated with survival periods (p = 0.0004), while early and late HFO amplitudes showed no significant association with survival (p = 0.4307, and p = 0.6858, respectively).ConclusionsThe HFO amplitude in ALS is increased, but does not predict survival.SignificanceThe enlarged HFOs in ALS might be a compensatory phenomenon to the hyperexcitability of the sensory cortex pyramidal neurons. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.
