Major depressive disorder and other neuropsychiatric disorders are often managed with long-term use of antidepressant medication. Fluoxetine, an SSRI antidepressant, is widely used as a first-line treatment for neuropsychiatric disorders. However, fluoxetine has also been shown to increase the risk of metabolic diseases such as non-alcoholic fatty liver disease. Fluoxetine has been shown to increase hepatic lipid accumulation in vivo and in vitro. In addition, fluoxetine has been shown to alter the production of prostaglandins which have also been implicated in the development of non-alcoholic fatty liver disease. The goal of this study was to assess the effect of fluoxetine exposure on the prostaglandin biosynthetic pathway and lipid accumulation in a hepatic cell line (H4-II-E-C3 cells). Fluoxetine treatment increased mRNA expression of prostaglandin biosynthetic enzymes (Ptgs1, Ptgs2, and Ptgds), PPAR gamma (Pparg), and PPAR gamma downstream targets involved in fatty acid uptake (Cd36, Fatp2, and Fatp5) as well as production of 15-deoxy-Δ12,14PGJ2 a PPAR gamma ligand. The effects of fluoxetine to induce lipid accumulation were attenuated with a PTGS1 specific inhibitor (SC-560), whereas inhibition of PTGS2 had no effect. Moreover, SC-560 attenuated 15-deoxy-Δ12,14PGJ2 production and expression of PPAR gamma downstream target genes. Taken together these results suggest that fluoxetine-induced lipid abnormalities appear to be mediated via PTGS1 and its downstream product 15d-PGJ2 and suggest a novel therapeutic target to prevent some of the adverse effects of fluoxetine treatment. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
ObjectivesSurvival extrapolation for chimeric antigen receptor T-cell therapies is challenging, owing to their unique mechanistic properties that translate to complex hazard functions. Axicabtagene ciloleucel is indicated for the treatment of relapse or refractory diffuse large B-cell lymphoma after 2 or more lines of therapy based on the ZUMA-1 trial. Four data snapshots are available, with minimum follow-up of 12, 24, 36, and 48 months. This analysis explores how survival extrapolations for axicabtagene ciloleucel using ZUMA-1 data can be validated and compared.MethodsThree different parametric modeling approaches were applied: standard parametric, spline-based, and cure-based models. Models were compared using a range of metrics, across the 4 data snapshot, including visual fit, plausibility of long-term estimates, statistical goodness of fit, inspection of hazard plots, point-estimate accuracy, and conditional survival estimates.ResultsStandard and spline-based parametric extrapolations were generally incapable of fitting the ZUMA-1 data well. Cure-based models provided the best fit based on the earliest data snapshot, with extrapolations remaining consistent as data matured. At 48 months, the maximum survival overestimate was 8.3% (Gompertz mixture-cure model) versus the maximum underestimate of 33.5% (Weibull standard parametric model).ConclusionsWhere a plateau in the survival curve is clinically plausible, cure-based models may be helpful in making accurate predictions based on immature data. The ability to reliably extrapolate from maturing data may reduce delays in patient access to potentially lifesaving treatments. Additional research is required to understand how models compare in broader contexts, including different treatments and therapeutic areas. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.
Background: Gait disorders are common in Parkinson’s disease patients who respond poorly to dopaminergic treatment. Blockade of adenosine A2A receptors is expected to improve gait disorders. Istradefylline is a first-in-class selective adenosine A2A receptor antagonist with benefits for motor complications associated with Parkinson’s disease.
Research design and methods: This multicenter, open-label, single-group, prospective interventional study evaluated changes in total gait-related scores of the Part II/III Movement Disorder Society-Unified Parkinson’s Disease Rating Scale (MDS-UPDRS) and Freezing of Gait Questionnaire (FOG-Q) in 31 Parkinson’s disease patients treated with istradefylline. Gait analysis by portable gait rhythmogram was performed.
Results: MDS-UPDRS Part III gait-related total scores significantly decreased at Weeks 4–12 from baseline with significant improvements in gait, freezing of gait, and postural stability. Significant decreases in MDS-UPDRS Part II total scores and individual item scores at Week 12 indicated improved daily living activities. At Week 12, there were significant improvements in FOG-Q, new FOG-Q, and overall movement per 48 h measured by portable gait rhythmogram. Adverse events occurred in 7/31 patients.
Conclusions: Istradefylline improved gait disorders in Parkinson’s disease patients complicated with freezing of gait, improving their quality of life. No unexpected adverse drug reactions were identified.
