Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
The objectives of this study were to factor analyze the Moral Distress Scale–Revised (MDS-R) in NICU nurses and to evaluate the relationships among dimensions of the MDS-R and the demoralization, exhaustion, and loss of motive dimensions of the Burnout Measure (BM). A total of 142 NICU nurses completed modified pen-and-paper versions of the MDS-R and BM. Exploratory and confirmatory factor analyses showed that the MDS-R-14 was a relatively good fit for the data. The compromised care dimension predicted BM demoralization (β = 0.24) and exhaustion (β = 0.22), the futile care dimension predicted BM exhaustion (β = 0.18), and the untruthful care dimension predicted BM demoralization (β = .25). Strategies to mitigate moral distress and resulting burnout in NICU nurses should address futile care, compromised care, and untruthful care. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.
ObjectivesTo determine the prevalence of restless legs syndrome (RLS) and RLS-mimic conditions, the risk factors for RLS, and whether RLS contributes to functional impairment in children and adolescents with attention-deficit/hyperactivity disorder (ADHD).MethodsADHD children and adolescents were prospectively studied at the outpatient psychiatric clinic. A trained registered nurse used the 2012 Revised International Restless Legs Syndrome Study Group diagnostic criteria to diagnose RLS. Sociodemographic data and medical records were reviewed. Weiss Functional Impairment Rating Scale-Parent Report (WFIRS-P) Thai version was used to identify association between RLS and 6 domains of function [family, school (learning), school (behavior), life skills, child self-concept, social activities, and risky activities].ResultsA total of 217 patients were included. Of those, 23 (11%) patients met the criteria for RLS, and 49 (23%) had RLS-mimic conditions. Those conditions included myalgia (30/49), habitual foot tapping (23/49), positional discomfort (20/49), leg ulcer/bruise (1/49), and arthralgia/arthritis (1/49). Binary logistic regression revealed first-degree relative having RLS symptom to be significantly associated with RLS in study patients (OR: 5.06, p < 0.01). Multivariate linear regression showed RLS to be independently associated with school (behavior) (Β = 1.18, p = 0.05) and life skills (Β = 2.36, p = 0.05) impairment.ConclusionsRLS was found to be common in ADHD children and adolescents. RLS-mimic conditions were found in two-thirds of patients who previously met 4 essential RLS criteria. First-degree relative with RLS symptom was associated with RLS, and RLS was associated with functional impairment in the life skills and school (behavior) domains. 相似文献
