BackgroundTo investigate perioperative complication rates at radical nephrectomy (RN) according to inferior vena cava thrombectomy (IVC-T) status and stage (metastatic vs non-metastatic) within kidney cancer patients.Materials and methodsWe ascertained perioperative complication rates within the National Inpatient Sample database (2016–2019). First, log-link linear Generalized Estimating Equation function (GEE) regression models (adjusted for hospital clustering and weighted for discharge disposition) tested complication rates in IVC-T patients, according to metastatic stage. Subsequently, a subgroup analysis relied on RN patients with or without IVC-T. Here, multivariable logistic regression models tested complication rates in RN patients according to IVC-T status, after propensity score matching including metastatic stage.ResultsOf 26,299 RN patients, 461 (2%) patients underwent IVC-T. Of those, 252 (55%) were non-metastatic vs 209 (45%) were metastatic. Rates of acute kidney injury (AKI), transfusion, cardiac, thromboembolic and other medical complications in non-metastatic vs metastatic patients were 40 vs 40%, 25 vs 22%, 21 vs 23%, 19 vs 14% and 38 vs 40%, respectively (all p ≥ 0.2). Metastatic stage in IVC-T patients did not predict differences in complications in log-link linear GEE regression models (all p > 0.1). However, in logistic regression models with propensity score matching, relying on the overall cohort of RN patients, IVC-T status was associated with higher complication rates (all p < 0.001): AKI (Odds ratio [OR]:2.60; 95%-CI [95%-Confidence interval: 1.97–3.44), transfusions (OR:2.40; 95%-CI: 1.72–3.36), cardiac (OR:2.27; 95%-CI: 1.49–3.47), thromboembolic (OR:9.07; 95%-CI: 5.21–16.58) and other medical complications (OR:2.01; 95%-CI: 1.52–2.66).ConclusionsThe current analyses indicate that presence of concomitant IVC-T is associated with higher complication rate at RN. Conversely, metastatic stage has no effect on recorded complication rates. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.
