Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Cutaneous leiomyomas are rare benign smooth‐muscle tumors. These lesions are distinguished based on their cell of origin and are subclassified as pilar leiomyoma, angioleiomyoma, and genital‐type leiomyoma. Nipple leiomyoma is the least common genital‐type leiomyoma, arising from the dartoic muscle cell of the nipple. Histologic examination of the lesion is necessary for definitive diagnosis, and these uncommon tumors can pose a diagnostic challenge. We describe herein a series of six nipple leiomyomas with a spectrum of histologic appearances. 相似文献
Although dose reduction of S‐1 is recommended for patients with impaired renal function, dose modification for such patients has not been prospectively evaluated. The aim of the present study was to investigate the pharmacokinetic parameters of 5‐fluorouracil, 5‐chloro‐2,4 dihydroxypyridine and oteracil potassium, and to review the recommended dose modification of S‐1 in patients with renal impairment. We classified patients receiving S‐1 into 4 groups according to their renal function, as measured using the Japanese estimated glomerular filtration rate (eGFR) equation. The daily S‐1 dose was adjusted based on the patient's eGFR and body surface area. Blood samples were collected for pharmacokinetic analysis. A total of 33 patients were enrolled and classified into 4 groups as follows: 10 patients in cohort 1 (eGFR ≥ 80 mL/min/1.73 m2), 10 patients in cohort 2 (eGFR = 50‐79 mL/min/1.73 m2), 10 patients in cohort 3 (eGFR = 30‐49 mL/min/1.73 m2), and 3 patients in cohort 4 (eGFR < 30 mL/min/1.73 m2). Those in cohorts 3 and 4 treated with an adjusted dose of S‐1 showed a similar area under the curve for 5‐fluorouracil (941.9 ± 275.6 and 1043.5 ± 224.8 ng/mL, respectively) compared with cohort 2 (1034.9 ± 414.3 ng/mL). Notably, while there was a statistically significant difference between cohort 1 (689.6 ± 208.8 ng/mL) and 2 (P =0.0474) treated with an equal dose of S‐1, there was no significant difference observed in the toxicity profiles of the cohorts. In conclusion, dose adjustment of S‐1 in patients with impaired renal function using eGFR is appropriate and safe. 相似文献
Among the chief limitations in achieving early detection and control of animal‐origin influenza of pandemic potential in high‐risk livestock populations is the existing lag time between sample collection and diagnostic result. Advances in molecular diagnostics are permitting deployment of affordable, rapid, highly sensitive, and specific point‐of‐capture assays, providing opportunities for targeted surveillance driving containment strategies with potentially compelling returns on investment. Interrupting disease transmission at source holds promise of disrupting cycles of animal‐origin influenza incursion to endemicity and limiting impact on animal production, food security, and public health. Adoption of new point‐of‐capture diagnostics should be undertaken in the context of promoting robust veterinary services systems and parallel support for operationalizing pre‐authorized plans and communication strategies that will ensure that the full potential of these new platforms is realized. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献