ObjectiveNew-onset postoperative atrial fibrillation (POAF) after cardiac surgery is common, with rates up to 60%. POAF has been associated with early and late stroke, but its association with other cardiovascular outcomes is less known. The objective was to perform a meta-analysis of the studies reporting the association of POAF with perioperative and long-term outcomes in patients with cardiac surgery.MethodsWe performed a systematic review and a meta-analysis of studies that presented outcomes for cardiac surgery on the basis of the presence or absence of POAF. MEDLINE, EMBASE, and the Cochrane Library were assessed; 57 studies (246,340 patients) were selected. Perioperative mortality was the primary outcome. Inverse variance method and random model were performed. Leave-one-out analysis, subgroup analyses, and metaregression were conducted.ResultsPOAF was associated with perioperative mortality (odds ratio [OR], 1.92; 95% confidence interval [CI], 1.58-2.33), perioperative stroke (OR, 2.17; 95% CI, 1.90-2.49), perioperative myocardial infarction (OR, 1.28; 95% CI, 1.06-1.54), perioperative acute renal failure (OR, 2.74; 95% CI, 2.42-3.11), hospital (standardized mean difference, 0.80; 95% CI, 0.53-1.07) and intensive care unit stay (standardized mean difference, 0.55; 95% CI, 0.24-0.86), long-term mortality (incidence rate ratio [IRR], 1.54; 95% CI, 1.40-1.69), long-term stroke (IRR, 1.33; 95% CI, 1.21-1.46), and longstanding persistent atrial fibrillation (IRR, 4.73; 95% CI, 3.36-6.66).ConclusionsThe results suggest that POAF after cardiac surgery is associated with an increased occurrence of most short- and long-term cardiovascular adverse events. However, the causality of this association remains to be established. 相似文献
??Objective To discuss the influence of basic periodontal therapy on the level of IL-8?? IL-10 in serum and gingival crevicular fluid in patients who have chronic periodontitis complicated by coronary heart disease. Methods A total of 65 cases of patients with chronic periodontitis complicated by coronary heart disease were selected and divided into two groups randomly??Group A of 35 patients who received the basic periodontal therapy and cardiac medical treatment??Group B of 30 patients who received cardiological treatment only. Then??select 25 patient who had developed chronic severe periodontitis with non-systematic disease to establish group C and give them the basic periodontal therapy only. Observe the changes of the IL-8??IL-10 levels in serum and gingival crevicular fluid and the periodontal infection indexes??BI??PD??. Results The results showed that after three months of basic periodontal therapy the periodontal clinical indices of both group A and group C became better and the IL-8 level obviously reduced??while the IL-10 level obviously increased. There was no obvious difference between group A and group B in each examination index before the therapy. After three months??we found that the periodontal infection index??SBI PD??of group A was obviously better than group B. Compared to group B??the IL-8 level of group A obviously reduced??and the IL-10 level obviously increased. The difference was statistically significant??P < 0.05??. Conclusion The basic periodontal therapy can effectively improve periodontal conditions of the patients with chronic periodontal diseases??and reduce the risk of breaking the normal cardiovascular function. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献