Background and ObjectiveVaccine uptake during pregnancy remains low. Our objectives were to describe 1) development and adaptation of a clinician communication training intervention for maternal immunizations and 2) obstetrics and gynecology (ob-gyn) clinician and staff perspectives on the intervention and fit for the prenatal care context.MethodsDesign of the Motivational Interviewing for Maternal Immunizations (MI4MI) intervention was based on similar communication training interventions for pediatric settings and included presumptive initiation of vaccine recommendations (“You’re due for two vaccines today”) combined with motivational interviewing (MI) for hesitant patients. Interviews and focus group discussions were conducted with ob-gyn clinicians and staff in five Colorado clinics including settings with obstetric physicians, certified nurse midwives (CNMs), and clinician-trainees. Participants were asked about adapting training to the ob-gyn setting and their implementation experiences. Feedback was incorporated through iterative changes to training components.ResultsInterview and focus group discussion results from participants before (n = 3), during (n = 11) and after (n = 25) implementation guided intervention development and adaptation. Three virtual, asynchronous training components were created: a video and two interactive modules. This virtual format was favored due to challenges attending group meetings; however, participants noted opportunities to practice skills through role-play were lacking. Training modules were adapted to include common challenging vaccine conversations and live-action videos. Participants liked interactive training components and use of adult learning strategies. Some participants initially resisted the presumptive approach but later found it useful after applying it in their practices. Overall, participants reported that MI4MI training fit well with the prenatal context and recommended more inclusion of non-clinician staff.ConclusionsMI4MI training was viewed as relevant and useful for ob-gyn clinicians and staff. Suggestions included making training more interactive, and including more complex scenarios and non-clinician staff. 相似文献
ObjectivesTo investigate the subcortical somatosensory evoked potentials (SEPs) to electrical stimulation of either muscle or cutaneous afferents.MethodsSEPs were recorded in 6 patients suffering from Parkinson’s disease (PD) who underwent electrode implantation in the pedunculopontine (PPTg) nucleus area. We compared SEPs recorded from the scalp and from the intracranial electrode contacts to electrical stimuli applied to: 1) median nerve at the wrist, 2) abductor pollicis brevis motor point, and 3) distal phalanx of the thumb. Also the high-frequency oscillations (HFOs) were analysed.ResultsAfter median nerve and pure cutaneous (distant phalanx of the thumb) stimulation, a P1-N1 complex was recorded by the intracranial lead, while the scalp electrodes recorded the short-latency far-field responses (P14 and N18). On the contrary, motor point stimulation did not evoke any low-frequency component in the PPTg traces, nor the N18 potential on the scalp. HFOs were recorded to stimulation of all modalities by the PPTg electrode contacts.ConclusionsStimulus processing within the cuneate nucleus depends on modality, since only the cutaneous input activates the complex intranuclear network possibly generating the scalp N18 potential.SignificanceOur results shed light on the subcortical processing of the somatosensory input of different modalities. 相似文献
In this paper, we argue that understanding and addressing the problem of poor-quality medical products requires a more interdisciplinary approach than has been evident to date. While prospective studies based on rigorous standardized methodologies are the gold standard for measuring the prevalence of poor-quality medical products and understanding their distribution nationally and internationally, they should be complemented by social science research to unpack the complex set of social, economic, and governance factors that underlie these patterns. In the following sections, we discuss specific examples of prospective quality surveys and of social science studies, highlighting the value of cross-sector partnerships in driving high-quality, policy-relevant research in this area. 相似文献
Background/PurposeA small number of Hirschsprung disease (HD) patients develop inflammatory bowel disease (IBD)-like symptoms after pullthrough surgery. The etiology and pathophysiology of Hirschsprung-associated IBD (HD-IBD) remains unknown. This study aims to further characterize HD-IBD, to identify potential risk factors and to evaluate response to treatment in a large group of patients.MethodsRetrospective study of patients diagnosed with IBD after pullthrough surgery between 2000 and 2021 at 17 institutions. Data regarding clinical presentation and course of HD and IBD were reviewed. Effectiveness of medical therapy for IBD was recorded using a Likert scale.ResultsThere were 55 patients (78% male). 50% (n = 28) had long segment disease. Hirschsprung-associated enterocolitis (HAEC) was reported in 68% (n = 36). Ten patients (18%) had Trisomy 21. IBD was diagnosed after age 5 in 63% (n = 34). IBD presentation consisted of colonic or small bowel inflammation resembling IBD in 69% (n = 38), unexplained or persistent fistula in 18% (n = 10) and unexplained HAEC >5 years old or unresponsive to standard treatment in 13% (n = 7). Biological agents were the most effective (80%) medications. A third of patients required a surgical procedure for IBD.ConclusionMore than half of the patients were diagnosed with HD-IBD after 5 years old. Long segment disease, HAEC after pull through operation and trisomy 21 may represent risk factors for this condition. Investigation for possible IBD should be considered in children with unexplained fistulae, HAEC beyond the age of 5 or unresponsive to standard therapy, and symptoms suggestive of IBD. Biological agents were the most effective medical treatment.Level of EvidenceLevel 4 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献