IntroductionAnti-scatter grids efficiently reduce scatter radiation from reaching the imaging receptor, enhancing image quality; however, the patient radiation dose increases in the process. There is disagreement regarding the thickness thresholds for which anti-scatter grids are beneficial. This study aims to establish a thickness threshold for the use of anti-scatter grids to optimise adult knee radiography.MethodsThe study consisted of two phases. In Phase 1 phantom knee radiographs were acquired at varying thicknesses (10–16 cm) and tube voltages (60–80 kV). For each thickness and tube voltage, images with and without an anti-scatter grid were obtained. In Phase 2, two radiologists and three radiographers, evaluated the image quality of these images. Visual Grading Analysis (VGA) scores were analysed using Visual Grading Characteristics (VGC) based on the visualisation of five anatomic criteria.ResultsThe average DAP decreased by 72.1% and mAs by 73.1% when removing the anti-scatter grid. The VGC revealed that overall images taken with an anti-scatter grid have better image quality (AUC ≥0.5 for all comparisons). However, the anti-scatter grids could be removed for thicknesses 10, 12 and 14 cm in conjunction with using 80 kVp,.ConclusionAnti-scatter grids can be removed when imaging adult knees between 10 and 12 cm using any kVp setting since the radiation dose is reduced without significantly affecting image quality. For thicknesses >12 cm, the use of anti-scatter grids significantly improves image quality; however, the radiation dose to the patient is increased. The exception is at 14 cm used with 80 kVp, where changes in image quality were insignificant.Implications for practiceOptimisation by removing anti-scatter grids in adult knee radiography seems beneficial below 12 cm thickness with any kVp value. Since the average knee thickness ranges between 10 and 13 cm, anti-scatter grid can be removed for most patients. Nevertheless, further studies are recommended to test if this phantom-based threshold applies to human subjects. 相似文献
Amacrine cells of the retina are conspicuously variable in their morphologies, their population demographics, and their ensuing functions. Vesicular glutamate transporter 3 (VGluT3) amacrine cells are a recently characterized type of amacrine cell exhibiting local dendritic autonomy. The present analysis has examined three features of this VGluT3 population, including their density, local distribution, and dendritic spread, to discern the extent to which these are interrelated, using male and female mice. We first demonstrate that Bax-mediated cell death transforms the mosaic of VGluT3 cells from a random distribution into a regular mosaic. We subsequently examine the relationship between cell density and mosaic regularity across recombinant inbred strains of mice, finding that, although both traits vary across the strains, they exhibit minimal covariation. Other genetic determinants must therefore contribute independently to final cell number and to mosaic order. Using a conditional KO approach, we further demonstrate that Bax acts via the bipolar cell population, rather than cell-intrinsically, to control VGluT3 cell number. Finally, we consider the relationship between the dendritic arbors of single VGluT3 cells and the distribution of their homotypic neighbors. Dendritic field area was found to be independent of Voronoi domain area, while dendritic coverage of single cells was not conserved, simply increasing with the size of the dendritic field. Bax-KO retinas exhibited a threefold increase in dendritic coverage. Each cell, however, contributed less dendrites at each depth within the plexus, intermingling their processes with those of neighboring cells to approximate a constant volumetric density, yielding a uniformity in process coverage across the population.SIGNIFICANCE STATEMENT Different types of retinal neuron spread their processes across the surface of the retina to achieve a degree of dendritic coverage that is characteristic of each type. Many of these types achieve a constant coverage by varying their dendritic field area inversely with the local density of like-type neighbors. Here we report a population of retinal amacrine cells that do not develop dendritic arbors in relation to the spatial positioning of such homotypic neighbors; rather, this cell type modulates the extent of its dendritic branching when faced with a variable number of overlapping dendritic fields to approximate a uniformity in dendritic density across the retina. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
In the work described here, our aim was to determine, in an elderly population, changes in muscle thickness (MT), cross-sectional area (CSA) and echo intensity (EI) of the quadriceps muscles at four time points (0, 5, 10 and 15 min; i.e., T0, T5, T10 and T15, respectively) after changing from a standing to supine position. Twenty-one elderly participants (14 men: 68.1 ± 4.6 y; 8 women: 66.8 ± 4.1 y) were evaluated at four time points. Rectus femoris CSA (RFCSA), MT and EI of the quadriceps femoris (QF) muscles were assessed. EI significantly increased from T0 to T5, T10 and T15 (p < 0.001), whereas no differences were observed between T5 and T15 in the rectus femoris (RFEI), vastus intermedius (VIEI) and quadriceps femoris (QFEI). No differences were observed between any time points in the RFCSA and MT of QF muscles. In summary, these results suggest that periods >5 min are not necessary to obtain consistent MT and EI measurements of quadriceps femoris muscles in the elderly population. 相似文献