Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
??Objective To discuss the influence of basic periodontal therapy on the level of IL-8?? IL-10 in serum and gingival crevicular fluid in patients who have chronic periodontitis complicated by coronary heart disease. Methods A total of 65 cases of patients with chronic periodontitis complicated by coronary heart disease were selected and divided into two groups randomly??Group A of 35 patients who received the basic periodontal therapy and cardiac medical treatment??Group B of 30 patients who received cardiological treatment only. Then??select 25 patient who had developed chronic severe periodontitis with non-systematic disease to establish group C and give them the basic periodontal therapy only. Observe the changes of the IL-8??IL-10 levels in serum and gingival crevicular fluid and the periodontal infection indexes??BI??PD??. Results The results showed that after three months of basic periodontal therapy the periodontal clinical indices of both group A and group C became better and the IL-8 level obviously reduced??while the IL-10 level obviously increased. There was no obvious difference between group A and group B in each examination index before the therapy. After three months??we found that the periodontal infection index??SBI PD??of group A was obviously better than group B. Compared to group B??the IL-8 level of group A obviously reduced??and the IL-10 level obviously increased. The difference was statistically significant??P < 0.05??. Conclusion The basic periodontal therapy can effectively improve periodontal conditions of the patients with chronic periodontal diseases??and reduce the risk of breaking the normal cardiovascular function. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.
Gut bacteria and gut barrier plays important roles in body homeostasis. Ciprofloxacin (CPFX) is widely used to treat bacterial infections. However, whether high dosage of CPFX has side effects on gut barrier integrity is still unclear. Our results indicated that the High CPFX treatment (1 mg/ml) caused weight loss, nervousness, anorexia, and increased apoptosis cells in gut, but less influence was observed in the Low CPFX group (0.2 mg/ml). Meanwhile, the High CPFX treatment impaired tight junction molecules Ocln/ZO-1 level and down-regulated antibacterial genes expression (reg3γ, pla2g2α and defb1). Further, the High CPFX treatment increased pro-inflammatory cytokine IL-1β in intestinal tract, decreased IL-17A of duodenum but increased IL-17A of colon at day 37. In addition, the gut bacterial diversity and richness behaved significantly loss regarding CPFX treatment, especially in the High CPFX group during the experiment. Indole exhibited sharply decline in both Low and High CPFX groups at day 7, and the High CPFX mice needed longer time on restoring indole level. Meanwhile, CPFX treatment strongly decreased the concentrations of butyric acid and valeric acid at day 1. Correlation analysis indicated that the linked patterns between the key bacteria (families Bacteroidales_S247, Ruminococcaceae and Desulfovibrionaceae) and metabolites (indole and butyric acid) were disturbed via the CPFX treatment. In conclusion, the High CPFX treatment impaired the gut barrier with the evidence of reduced expression of tight junction proteins, increased apoptosis cells and inflammatory cells, decreased the bacterial diversity and composition, which suggesting a proper antibiotic-dosage use should be carefully considered in disease treatment. 相似文献