Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
PurposeTo assess the feasibility, safety, and efficacy of balloon-assisted delivery of ethylene vinyl alcohol copolymer (EVOH) for a range of peripheral arterial applications.Materials and MethodsSix academic medical centers entered retrospective data on 46 consecutive patients (27 men, 19 women; ages, 11–94 y; mean age, 50.3 y) who underwent 60 balloon-assisted EVOH procedures. The cohort was restricted to procedures involving peripheral, nonneural arteries 1–5.5 mm in diameter. Clinical indications included a wide range of vascular pathologic conditions (most commonly arteriovenous malformations [n = 20], renal angiomyolipomas [n = 8], and acute hemorrhage [n = 9]) and targeted visceral and musculoskeletal peripheral arteries. Data collected included sex, age, clinical indication, arterial pathology, arteries embolized, type of occlusion balloon microcatheter, type and concentration of EVOH agent, effectiveness as an embolic backstop, vessels protected, adequacy of EVOH cast penetration, catheter extraction, nontarget embolization, and complications.ResultsBalloon occlusion prevented EVOH reflux in 59 of 60 procedures (98.3%). Nontarget EVOH embolization occurred in 2 procedures (3.3%). Adequate EVOH cast penetration and complete filling of the target pathologic structure were seen in 57 of 60 procedures (95%). Balloon deflation and uneventful extraction occurred in all procedures; small EVOH fragments detached into target arteries in 2 cases. One major (1.7%) and 2 minor (3.3%) complications occurred.ConclusionsBalloon-assisted EVOH embolization of peripheral arteries is feasible, safe, effective, and versatile. The primary advantage of balloon-assisted EVOH embolization is the ability to apply more injection pressure to advance the EVOH cast assertively into the pathologic structure(s). 相似文献
PurposeTo explore the safety and effectiveness of bronchial artery (BA) embolization (BAE) in children with pulmonary hemorrhage.Materials and MethodsBetween February 2016 and February 2019, 41 patients (median age, 4 y; interquartile range, 2.3-8 y; median weight, 17.6 kg; interquartile range, 12.3–23.6 kg) underwent BAE. The indication of BAE included massive hemoptysis in 10 patients (24.4%), recurrent hemoptysis in 18 patients (43.9%), and refractory anemia in 13 patients (31.7%). The main etiology of pulmonary hemorrhage included pulmonary hemosiderosis (58.5%), congenital heart disease (17.1%), and infection (14.6%). A retrospective review was conducted of clinical outcomes of BAE.ResultsThere were 44 embolization sessions, with a total of 137 embolized vessels. Pulmonary hemorrhage was caused by BAs in 30 cases, nonbronchial systemic arteries plus BAs in 10, and nonbronchial systemic arteries in 1. Embolic particles were used in 30 cases (24 polyvinyl alcohol [PVA] and 6 microsphere), coils in 9 cases, and particles plus coils in 5 cases (4 PVA and 1 microsphere). Technical success (ability to embolize abnormal vessel) was achieved in 97.6% of patients (40 of 41), and clinical success (complete or partial resolution of hemoptysis within 30 days of embolization) was achieved in 90.2% (37 of 41). There was 1 procedure-related complication (2.4%) of cerebral infarction and 1 death from multiple-organ dysfunction (2.4%). Bleeding-free survival rates at 6, 12, 24, and 36 months were 92.5%, 83.9%, 83.9%, and 70.8%, respectively.ConclusionsBAE is a safe and effective procedure in children with pulmonary hemorrhage. 相似文献