Education Outcomes of Children Born Late Preterm: A Retrospective Whole-Population Cohort Study

Maternal and Child Health Journal - Early life exposures can have an impact on a child’s developmental trajectory and children born late preterm (34–36 weeks gestational age)...     

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

A comparison of the academic impact of plastic surgery units in the United Kingdom and Ireland using bibliometric analysis

Academic output is just one aspect of a successful career as a plastic surgeon. However, for those with a strong interest in academia, the academic output of a department will likely be a key factor when deciding how to rank jobs. The aim of this study was to quantify and rank the academic output of plastic surgery units across the UK and Ireland. The Institute for Scientific Information (ISI) Web of Science Bibliometric analysis tool was used to collate cumulative (1950–2016), 10 year (2006–2016) and 3 years (2013–2015) research output data for plastic surgery units in the UK and Ireland. Sixty-six plastic surgery units were identified. Departments were ranked for each time period according to the number of papers produced, number of citations (Nc) and h-index (a measure of the impact of scientific output). The top 3 departments for number of papers in the last 10 years were The Royal Free Hospital, London (226) Broomfield Hospital, Chelmsford (218), and Morriston Hospital and Swansea (188). The top 3 for h-number were The Royal Free Hospital (21) Wythenshawe Hospital, Manchester (18) and Morriston Hospital (17). Academic output varies across plastic surgery units in the UK and Ireland. A number of departments have consistently maintained high academic outputs across the years and will be of interest to surgeons hoping to pursue a career in academia.