Anaplastic thyroid carcinoma: diagnostic challenges,histopathologic features and ancillary testing

Anaplastic thyroid carcinoma (ATC) is an aggressive thyroid malignancy with high mortality rate. This malignancy arises in thyroid follicular cells either denovo or with an associated differentiated thyroid carcinoma component. Clinically, it usually presents as a rapidly enlarging mass, pain and locally compressive symptoms. Histopathologic variability and heterogeneity often pose diagnostic challenges, especially in scant and paucicellular specimens. This article describes the clinical, histopathologic and molecular features of ATC and also addresses the associated diagnostic limitations and challenges.     

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Differential diagnosis of diarrhoea in patients with neuroendocrine tumours:A systematic review

BACKGROUND Approximately 20% of patients with neuroendocrine tumours(NETs) develop carcinoid syndrome(CS),characterised by flushing and diarrhoea.Somatostatin analogues or telotristat can be used to control symptoms of CS through inhibition of serotonin secretion.Although CS is often the cause of diarrhoea among patients with gastroenteropancreatic NETs(GEP-NETs),other causes to consider include pancreatic enzyme insufficiency(PEI),bile acid malabsorption and small intestinal bacterial overgrowth.If other causes of diarrhoea unrelated to serotonin secretion are mistaken for CS diarrhoea,these treatments may be ineffective against the diarrhoea,risking detrimental effects to patient quality of life.AIM To identify and synthesise qualitative and quantitative evidence relating to the differential diagnosis of diarrhoea in patients with GEP-NETs.METHODS Electronic databases(MEDLINE,Embase and the Cochrane Library) were searched from inception to September 12,2018 using terms for NETs and diarrhoea.Congresses,systematic literature review bibliographies and included articles were also hand-searched.Any study designs and publication types were eligible for inclusion if relevant data on a cause(s) of diarrhoea in patients with GEP-NETs were reported.Studies were screened by two independent reviewers at abstract and full-text stages.Framework synthesis was adapted to synthesise quantitative and qualitative data.The definition of qualitative data was expanded to include all textual data in any section of relevant publications.RESULTS Forty-seven publications(44 studies) were included,comprising a variety of publication types,including observational studies,reviews,guidelines,case reports,interventional studies,and opinion pieces.Most reported on PEI on/after treatment with somatostatin analogs;9.5%-84% of patients with GEP-NETs had experienced steatorrhoea or confirmed PEI.Where reported,14.3%–50.7% of patients received pancreatic enzyme replacement therapy.Other causes of diarrhoea reported in patients with GEP-NETs included bile acid malabsorption(80%),small intestinal bacterial overgrowth(23.6%-62%),colitis(20%) and infection(7.1%).Diagnostic approaches included faecal elastase,breath tests,tauroselcholic(selenium-75) acid(Se HCAT) scan and stool culture,although evidence on the effectiveness or diagnostic accuracy of these approaches was limited.Assessment of patient history or diarrhoea characteristics was also reported as initial approaches for investigation.From the identified evidence,if diarrhoea is assumed to be CS diarrhoea,consequences include uncontrolled diarrhoea,malnutrition,and perceived ineffectiveness of CS treatment.Approaches for facilitating differential diagnosis of diarrhoea include improving patient and clinician awareness of non-CS causes and involvement of a multidisciplinary clinical team,including gastroenterologists.CONCLUSION Diarrhoea in GEP-NETs can be multifactorial with misdiagnosis leading to delayed patient recovery and inefficient resource use.This systematic literature review highlights gaps for further research on prevalence of non-CS diarrhoea and suitability of diagnostic approaches,to determine an effective algorithm for differential diagnosis of GEP-NET diarrhoea.     

Estimation of phase signal change in neuronal current MRI for evoke response of tactile detection with realistic somatosensory laminar network model

Magnetic field generated by neuronal activity could alter magnetic resonance imaging (MRI) signals but detection of such signal is under debate. Previous researches proposed that magnitude signal change is below current detectable level, but phase signal change (PSC) may be measurable with current MRI systems. Optimal imaging parameters like echo time, voxel size and external field direction, could increase the probability of detection of this small signal change. We simulate a voxel of cortical column to determine effect of such parameters on PSC signal. We extended a laminar network model for somatosensory cortex to find neuronal current in each segment of pyramidal neurons (PN). 60,000 PNs of simulated network were positioned randomly in a voxel. Biot–savart law applied to calculate neuronal magnetic field and additional phase. The procedure repeated for eleven neuronal arrangements in the voxel. PSC signal variation with the echo time and voxel size was assessed. The simulated results show that PSC signal increases with echo time, especially 100/80 ms after stimulus for gradient echo/spin echo sequence. It can be up to 0.1 mrad for echo time = 175 ms and voxel size = 1.48 × 1.48 × 2.18 mm³. With echo time less than 25 ms after stimulus, it was just acquired effects of physiological noise on PSC signal. The absolute value of the signal increased with decrease of voxel size, but its components had complex variation. External field orthogonal to local surface of cortex maximizes the signal. Expected PSC signal for tactile detection in the somatosensory cortex increase with echo time and have no oscillation.     

Oral Dispersible System: A New Approach in Drug Delivery System

Dosage form is a mean used for the delivery of drug to a living body. In order to get the desired effect the drug should be delivered to its site of action at such rate and concentration to achieve the maximum therapeutic effect and minimum adverse effect. Since oral route is still widely accepted route but having a common drawback of difficulty in swallowing of tablets and capsules. Therefore a lot of research has been done on novel drug delivery systems. This review is about oral dispersible tablets a novel approach in drug delivery systems that are now a day''s more focused in formulation world, and laid a new path that, helped the patients to build their compliance level with the therapy, also reduced the cost and ease the administration especially in case of pediatrics and geriatrics. Quick absorption, rapid onset of action and reduction in drug loss properties are the basic advantages of this dosage form.     

Subcutaneous immunization with a novel immunogenic candidate (urease) confers protection against Brucella abortus and Brucella melitensis infections

Brucellosis is a world prevalent endemic illness that is transmitted from domestic animals to humans. Brucella spp. exploits urease for survival in the harsh conditions of stomach during the gastrointestinal infection. In this study, we examined the immune response and the protection elicited by using recombinant Brucella urease (rUrease) vaccination in BALB/c mice. The urease gene was cloned in pET28a and the resulting recombinant protein was employed as subunit vaccine. Recombinant protein was administered subcutaneously and intraperitoneally. Dosage reduction was observed with subcutaneous (SC) vaccination when compared with intraperitoneal (IP) vaccination. rUrease induced mixed Th1–Th2 immune responses with high titers of specific IgG1 and IgG2a. In lymphocyte proliferation assay, splenocytes from IP and SC‐vaccinated mice displayed a strong recall proliferative response with high amounts of IL‐4, IL‐12 and IFN‐γ production. Vaccinated mice were challenged with virulent Brucella melitensis, B. abortus and B. suis. The SC vaccination route exhibited a higher degree of protection than IP vaccination (p value ≤ 0.05). Altogether, our results indicated that rUrease could be a useful antigen candidate for the development of subunit vaccines against brucellosis.