A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Direct oral anticoagulants (DOACs) and neck of femur fractures: Standardising the perioperative management and time to surgery

Demographic projections for hip fragility fractures indicate a rising annual incidence by virtue of a multimorbid, ageing population with more noncommunicable diseases (NCDs). NCDs are characterised by slow progression and long duration ranging from ischaemic cardiovascular disease, cerebrovascular disease, diabetes, chronic obstructive pulmonary disease to various cancers. Management of this disease burden often involves commencing patients on oral anticoagulants to reduce the risk of thromboembolic events. The use of direct oral anticoagulants (DOACs) in clinical practice has increased due to their rapid onset of action, short half-life and predictable anticoagulant effects, without the need for routine monitoring. Safe and timely surgical intervention relies on reversal of anticoagulants. However, the lack of specific evidence-based guidelines for the perioperative management of patients on DOACs with hip fractures has proved challenging; in particular, the accessibility of DOAC-specific assays, justification of the cost-benefit ratio of targeted reversal agents and indications for neuraxial anaesthesia. This has led to potentially avoidable delays in surgical intervention. Following a literature review of the pharmacokinetic and pharmacodynamics of commonly used DOACs in our region including the role of surrogate markers, we propose a systematic, evidence-based guideline to the perioperative management of hip fractures DOACs. We believe this standardised protocol can be easily replicated between hospitals. We recommend that if patients are deemed suitable for a general anaesthesia, with satisfactory renal function, optimal surgical time should be 24 h following the last ingested dose of DOAC.     

Tobacco consumption,opium use,alcohol drinking and the risk of esophageal cancer in North Khorasan,Iran

Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.

Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.

Results: Our findings show Hookah smoking [OR = 6.1(CI_95%:1.2–13.1)] and opium consumption [OR = 2.1(CI_95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.

Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district.     

Identification of the medial femoral safe zone for drilling during dynamic hip screw side plate fixation: A CT angiogram tracing of the profunda femoris artery

Objectives

Iatrogenic injury of the Profunda Femoris Artery (PFA) at time of hip fixation surgery can increase morbidity and mortality and prolong the hospital stay. This is an injury that tends to pass unnoticed as a cause of postoperative deterioration despite being frequently reported in the literature. Our study aims to describe the anatomy of the PFA in relation to the medial femoral cortex with specific emphasis on its orientation relative to the position of a sliding hip screw side plate construct. By doing so we are able to present clear guidance to orthopaedic surgeons on how to avoid iatrogenic PFA injury at the time of hip fracture fixation.

Expression of TRIM22 mRNA in chronic hepatitis C patients treated with direct-acting antiviral drugs

Hepatitis C is a global public health problem, and Pakistan is the second largest country in the globe with highest prevalence rate of hepatitis C virus (HCV). Until 2014, pegylated interferon (PEG-IFN) plus ribavirin (RBV) has been the standard therapy for HCV, however, owing to its adverse side effects and very low sustained virologic response (SVR) rates therapeutics trend is shifted toward direct-acting antivirals. Tripartite motif containing 22 (TRIM22) is a dynamic antiviral protein that can inhibit multiple viruses in vivo. Expression of TRIM22 mRNA has been linked to outcome of PEG-IFN and ribavirin therapy, where its higher expression leads to rapid virus clearance. However, in terms of therapy with direct-acting antiviral (DAA) or double DAA, impact of TRIM22 expression is largely unknown. These new drugs show more than 90% of SVR rates and lesser side effects and have proven to be better than IFN therapy. Endogenous IFN system suppresses various pathogens through the induction of antiviral effectors termed as interferon-stimulating genes (ISGs). We have studied the expression levels of one of these antiviral effectors, TRIM22 in response to sofosbuvir (SOF) and daclatasvir (DAC) in combination with RBV, using quantitative PCR in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients. We have observed sustained virus clearance in more than 90% of patients treated with DAA and double DAA and have seen the expression of TRIM22 to be higher in patients who attained SVR as compared to the untreated patients. We have also observed downregulation of TRIM22 in patients who failed to attain rapid virus clearance, and upregulation in those who achieved rapid clearance of virus. Genetic factors that determine the lower TRIM22 expression in these patients are needed to be explored that may also play a role in lower response to anti-HCV therapy. Endogenous IFN system and effects of antiviral proteins in response to DAA therapy is needed to be studied in order to better understand the host response toward these drugs to make them more effective.     

Assessment of heavy metals by ICP-OES and their impact on insulin stimulating hormone and carbohydrate metabolizing enzymes

Arsenic (As) and cadmium (Cd) have recently emerged as major health concerns owing to their strong association with diabetes mellitus (DM). We aimed to investigate the heavy metals exposure towards incidence of DM at various enzymatic and hormonal levels. Additionally, association of As and Cd with Zinc (Zn, essential metal) was also evaluated. Spot urine samples were collected to assess As, Cd and Zn through ICP-OES. Serum was analyzed by assay method for fasting blood glucose, liver and renal function biomarkers. ELISA was performed to investigate the impact of heavy metals on HbA1c, α-amylase, DPP-IV, IGF-1, leptin, GSH, MDA, SOD, HDL, FFA, TG and interleukin (IL)-6. Association of heavy metals with DM was measured by odds ratio (OR) and level of significance was assessed by Chi-squared test. Unpaired student's t-test was used to compare DM-associated risk factors in heavy metals-exposed and unexposed participants. As and Cd were detectable in 75.4% and 83% participants with mean concentration of 75.5 ppb and 54.5 ppb, respectively. For As exposure, OR in the third quartile was maximum ie 1.34 (95% CI, 0.80 to 2.23), however the result was not statistically significant (P > .05). For Cd exposure, OR in the fourth quartile was considerably high, 1.62 (95% CI, 1.00 to 2.61), with a significant probability value (P < .05). Urinary Cd was negatively associated with Zn. As and Cd exposure increases the incidence of DM in the general population. Impaired hormonal and enzymatic levels in diabetic and non-diabetic exposed participants reflect the multiple organ damage by heavy metal exposure.     

Anaphylaxis

A 60 year old man attends to discuss his recent allergic reaction to an insect sting. He presents you with the casualty letter which reads ： ＂ Treated for anaphylaxis after bee sting-see GP for follow-up. ＂     

Primary adenocarcinoma of the appendix

Thirteen cases of primary appendicular adenocarcinoma are reported. This rare tumour usually presents as acute appendicitis. The correct diagnosis is rarely entertained before or during surgery. The main treatment choice lies between appendicectomy alone and appendicectomy followed by right hemicolectomy. There are anatomical reasons for advising the latter and survival figures from the literature tend to support this preference. The cases reported here indicate that in the period 1972-1984, in the North West Region, there was a slight preference for appendicectomy alone. The additional procedure of right hemicolectomy did not confer any clear-cut survival advantage.     

Exposure to electromagnetic fields and the risk of leukemia

Evidence from animal experiments and human studies suggests that electromagnetic fields may be human leukemogens. Epidemiological studies of leukemia in occupational groups and in the general populations are reviewed. The results are inconsistent. In the few studies showing an association between exposure to electromagnetic fields and the risk of leukemia, the temporal relationship between exposure and effect was not established, the observed associations were weak, the dose-response relationships were based on qualitative levels of exposure without regard to the duration of exposure or secondary sources of exposure, and the risk ratios were probably biased due to the population selection procedures used and misclassification of exposure. The proportionate mortality or cancer incidence ratios are unreliable estimates of relative risk. Further epidemiological research is needed to establish an association between exposure to electromagnetic fields and the risk of leukemia.