Iatrogenic epithelial change caused by endotracheal intubation of neonates

Tracheae of 20 neonates were obtained at postmortem examination. All neonates had been intubated for between 4 h and 105 days. The tracheal epithelial lining was examined by both light and scanning electron microscopy. Five tracheae which had never been intubated served as controls. All of these showed ciliation throughout their length. Those neonates who had been intubated showed epithelial change which ranged from a simple deciliation to a full stratified squamous epithelium. The degree of change was broadly related to the duration of intubation.     

Emergency free flaps to the type IIIC tibial fracture

Type IIIC tibial fractures are complex injuries involving extensive bone and soft-tissue devascularization that result in a high percentage of complications and ultimate amputation. An emergency free flap transfer not only may salvage the limb but also may improve the aesthetic and functional results of reconstruction by placing the injured structures in a well-vascularized bed. Two cases of type IIIC tibial fracture were treated in this manner, and we present our experience with a 30-month follow-up of one patient and a 6-month follow-up of another patient.     

Clinical and histopathological findings of ''psoriatic neurodermatitis'' and of typical lichen simplex chronicus

BACKGROUND: We have seen several patients with itchy lichenified plaques located bilaterally on the elbows and/or knees and have named this condition 'psoriatic neurodermatitis' (PN). OBJECTIVE: The purpose of this study was to compare clinical and histopathological characteristics of these patients to those of patients with typical lichen simplex chronicus (LSC). METHODS: Nineteen patients with PN and 34 patients with typical LSC were included. Besides clinical dermatological evaluation, the prick test was carried out on 49 patients; the Phadiatop test on 40 patients; the patch test with European standard series on 47 patients; histopathological evaluation on 39 patients; and clinical psychiatric examination on 38 patients. RESULTS: Almost exclusively, PN was seen in females and was located on the extremities. It caused more plaques than typical LSC did. In PN, the plaques were smaller, sharper, more keratotic and less excoriated, and had fewer lichenoid papules around them. Itching was usually more severe in the evening, while resting and in a hot environment in typical LSC, but not in PN. In plaques of PN, microabscesses in the horny layer, hypogranulosis, regular acanthosis and thinning of the suprapapillary plates were more frequent, and hyperpigmentation in the basal layer was less. In patients with PN, depressive disorder was found more frequently; and generalized anxiety disorder or psychosomatic characteristics, less. There were no significant differences in the results of prick, Phadiatop and patch tests between patients with PN and those with typical LSC. CONCLUSION: In our opinion, it is most likely that the so-called PN is itchy psoriasis superimposed by LSC.     

Treatment of refractoriness to platelet transfusion by protein A column therapy

Ten thrombocytopenic patients (platelets < 10–24 × 10(9)/L) who were refractory to platelet transfusion were investigated for their responsiveness to staphylococcal protein A column therapy. Nine patients had previously been treated with steroids, intravenous immune globulin, and/or other forms of immunosuppressive therapy without improvement in their transfusion response. All patients were receiving multiple platelet transfusions without achieving 1-hour corrected count increments (CCIs) > or = 7500. Eight patients had antibodies that reacted with platelets and were directed against HLA class I antigens, ABO antigens, and/or platelet-specific alloantigens. Plasma (500-2000 mL) from each patient was passed over a protein A silica gel column and then returned to the patient. Patients received from 1 to 14 treatments. A positive response to protein A therapy was defined as at least a doubling of the pretreatment platelet count and/or two successive 10- to 120-minute posttransfusion CCIs > or = 7500. Following plasma treatments, 6 of 10 patients responded with daily platelet counts that averaged 48 +/− 11 × 10(9) per L as compared with counts of 16 +/− 7 × 10(9) per L (p < 0.0005) before treatment. Posttransfusion CCI values determined in four of these patients averaged 2480 +/− 810 and 10,010 +/− 3540 (p < 0.005) before and after treatment, respectively. In contrast, among the four unresponsive patients, platelet counts averaged 10 +/− 9 and 13 +/− 10 × 10(9) per L (p = NS), respectively, while posttransfusion CCIs were 700 +/− 1410 and 1520 +/− 2460 (p = NS), respectively.(ABSTRACT TRUNCATED AT 250 WORDS)     

Solitary bronchioloalveolar carcinoma: CT criteria

The computed tomographic (CT) scans of 30 patients with solitary bronchioloalveolar carcinoma were reviewed. Common features at CT included the peripheral or subpleural location of a pulmonary mass (25 cases), pseudocavitation (18 cases), heterogeneous attenuation (17 cases), irregular margins forming a star pattern (22 cases), and pleural tags (21 cases). Using these CT criteria, four independent observers attempted to identify cases of bronchioloalveolar carcinoma from a larger sample of lung cancers and benign lesions by categorizing a series of test cases into four probability categories. Although the bronchioloalveolar carcinomas were correctly ranked in the two highest probability categories 75% of the time (in 45 of 60 cases), there was considerable overlap with other lung lesions, particularly with adenocarcinoma and large cell undifferentiated carcinoma. However, even though the typical features of bronchioloalveolar carcinoma are not invariable or highly specific, they are characteristic enough to suggest the diagnosis.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.