A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

A perception-based study to explore COVID-19 pandemic stress and its factors in Bangladesh

Background and aimsWorldwide the COVID-19 pandemic has accelerated sufferings of mental health and behaviour attitudes of people. Many countries, including Bangladesh, reported suicide as extreme consequences of the psychological burden influenced by COVID-19. The present study explores human stress and its factor influenced by COVID-19 in Bangladesh, which significantly affect the quality of life.MethodsAn online-based questionnaire survey was conducted among 651 adult Bangladeshi populations by capturing socio-demographic information, possible human stress, and consequences of the pandemic. A set of statistical tools such as Pearson's Correlation Matrix (PCM), T-test, Principal Component Analysis (PCA) and Hierarchical Cluster Analysis (HCA) were applied to identify the relationship between different factors and influential factors increasing human stress.ResultsMore than 83% of the participants are facing COVID-19 related mental stress, which results in short temper, sleep disorder, and family chaos. PCA and HCA outcomes indicated a significant relationship between the respondents' opinions and human stress factors, which harmonized with the country's existing scenario. PCM results enlighten the relationship between human stress factors and found financial hardship, cutting back daily spending, and food crisis are interconnected together causes stress. Also, hampering students' formal education and future career plans significantly contribute to mental stress.ConclusionBased on the above findings, it's crucial to introduce a time-oriented strategy and implement precaution monitoring plans for Bangladesh. The rescue plan will help people to manage the pandemic and improve mental health to fight against psychological challenges related to COVID-19 and future pandemics.     

Epilepsy in patients with insulin-dependent diabetes and relation to glutamic acid decarboxylase 65

Objectives:To report if the association of epilepsy in pediatric patients (below the age of 15 years) with Insulin-dependent Diabetes (IDDM) at King Fahad Medical City (KFMC) is higher than the prevalence of epilepsy in the same age group (who have no IDDM) in our community. Consequently, we would determine if there is a relationship between the presence of epilepsy in diabetic children and the presence of positive antiGAD65 antibodies.Methods:This cohort study included 305 pediatric patients below the age of 15 years with Insulin-dependent Diabetes Mellitus (IDDM). They were randomly recruited at the Pediatric Endocrinology Clinic in KFMC. The patients’ caregivers were given a questionnaire between December 2015 till March 2019 to determine the seizure disorder history. There was also a retrospective review of 214 patients’ files for anti-GAD 65 positivity.Results:Our study found a significant relation between the presence of epilepsy in children with IDDM. Therefore, we could confirm the relationship between the existence of epilepsy in children with IDDM and having positive GAD65 antibodies.Conclusion:Our study supports the presence of consistent relation between having IDDM and having epilepsy in children and between the latter and the presence of positive GAD65 antibodies.

Insulin dependent diabetes Mellitus (IDDM) is a common condition in children and adolescents worldwide and so is epilepsy.1,2 Recently, there were increasing reports suggesting a potential association between having IDDM and the occurrence of epilepsy.3 Their association might represent simply a chance to relate their underlying mechanisms. However, the cause-effect relationship is not fully well defined. Literature from other countries have shown the increased prevalence of seizure disorders in this group of patients.4,5 There are scarce studies in the literature investigating IDDM characteristics contributing to having epilepsy, including positive GAD 65 antibodies. In this study that ran in King Fahad Medical City, Riyadh, Kingdom of Saudi Arabia (KSA) we are aiming to determine if the prevalence of epilepsy among 1DDM children under the age of 15 years (in our center) is higher than controls (same age without IDDM), and to check the positivity of anti-GAD 65 amongst those patients in order to find if there is a relationship between epilepsy in children with diabetes and the presence of positive GAD65 Antibodies.     

Pseudoaneurysm in the inferior alveolar artery following a bad split in bilateral sagittal split osteotomy

Pseudoaneurysms in the external carotid artery system are rare, mostly reported in the superficial temporal and facial arteries. The bilateral sagittal split osteotomy has a low incidence of complications requiring emergency interventions. We report the case of a patient with acute bleeding from a pseudoaneurysm of the inferior alveolar artery diagnosed by angiography and treated successfully by super-selective embolization.     

Enhanced antitumour activity of doxorubicin and simvastatin combination loaded nanoemulsion treatment against a Swiss albino mouse model of Ehrlich ascites carcinoma

Doxorubicin (DOX) is the most commonly used anticancer drug; however, it has limited use because prolonged administration may result in severe cardiotoxicity. Simvastatin (SIM), generally prescribed for hypercholesterolaemia, has also shown salubrious results in the monotherapy or combinational drug therapy of different cancers in various models. Nanoparticle drug delivery systems are a novel way of improving therapeutics and also improving the absorption and specificity of drugs towards tumour cells. In this study, we exploited this technology to increase drug specificity and minimize imminent adverse effects. In this study, the antitumour activity of the combination formulas of DOX and SIM, either loaded in water (DOX‐SIM‐Solution) or nanoemulsions (NEs) (DOX‐SIM‐NE), was evaluated in a Swiss albino mouse model of Ehrlich ascites carcinoma. The anticancer effect was assessed by quantifying the change in body weight, mean survival time, and percent increase in lifespan (%ILS), determining haematological and serum biochemical parameters (liver function test, kidney function test and lipid profile parameters) as well as studying the histopathological alterations in liver tissues. We observed a clear increase in %ILS of the DOX‐SIM‐Solution group (265.30) that was double the %ILS of the DOX‐SIM‐NE group (134.70). However, DOX‐SIM‐NE had a non‐toxic effect on the haematological parameters, whereas DOX‐SIM‐Solution increased the levels of haemoglobin and lymphocytes. Furthermore, the encapsulation of SIM and DOX into NEs improved the levels of all serum biochemical parameters compared to the DOX‐SIM‐Solution. A reduction in the side effects of DOX‐SIM‐NE on the liver was also established using light microscopy, which revealed that the morphologies of the hepatocytes of the mice were less affected by administration of the DOX‐SIM‐NE treatment than with the DOX‐SIM‐Solution treatment. The study showed that incorporating SIM into the DOX‐loaded‐NE formulation remarkably improved its efficiency and simultaneously reduced its adverse effects.