A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Tobacco consumption,opium use,alcohol drinking and the risk of esophageal cancer in North Khorasan,Iran

Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.

Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.

Results: Our findings show Hookah smoking [OR = 6.1(CI_95%:1.2–13.1)] and opium consumption [OR = 2.1(CI_95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.

Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district.     

Identification of the medial femoral safe zone for drilling during dynamic hip screw side plate fixation: A CT angiogram tracing of the profunda femoris artery

Objectives

Iatrogenic injury of the Profunda Femoris Artery (PFA) at time of hip fixation surgery can increase morbidity and mortality and prolong the hospital stay. This is an injury that tends to pass unnoticed as a cause of postoperative deterioration despite being frequently reported in the literature. Our study aims to describe the anatomy of the PFA in relation to the medial femoral cortex with specific emphasis on its orientation relative to the position of a sliding hip screw side plate construct. By doing so we are able to present clear guidance to orthopaedic surgeons on how to avoid iatrogenic PFA injury at the time of hip fracture fixation.

Contemporary Use of Venoarterial Extracorporeal Membrane Oxygenation: Insights from the Multicenter RESCUE Registry

BackgroundVenoarterial extracorporeal membrane oxygenation (VA-ECMO) is increasingly used as a life-saving therapy for patients with cardiovascular collapse, but identifying patients unlikely to benefit remains a challenge.Methods and ResultsWe created the RESCUE registry, a retrospective, observational registry of adult patients treated with VA-ECMO between January 2007 and June 2017 at 3 high-volume centers (Columbia University, Duke University, and Washington University) to describe short-term patient outcomes. In 723 patients treated with VA-ECMO, the most common indications for deployment were postcardiotomy shock (31%), cardiomyopathy (including acute heart failure) (26%), and myocardial infarction (17%). Patients frequently suffered in-hospital complications, including acute renal dysfunction (45%), major bleeding (41%), and infection (33%). Only 40% of patients (n = 290) survived to discharge, with a minority receiving durable cardiac support (left ventricular assist device [n = 48] or heart transplantation [n = 7]). Multivariable regression analysis identified risk factors for mortality on ECMO as older age (odds ratio [OR], 1.26; 95% confidence interval [CI], 1.12–1.42) and female sex (OR, 1.44; 95% CI, 1.02–2.02) and risk factors for mortality after decannulation as higher body mass index (OR 1.17; 95% CI, 1.01-1.35) and major bleeding while on ECMO support (OR, 1.92; 95% CI, 1.23–2.99).ConclusionsDespite contemporary care at high-volume centers, patients treated with VA-ECMO continue to have significant in-hospital morbidity and mortality. The optimization of outcomes will require refinements in patient selection and improvement of care delivery.     

COVID-19 and hematology findings based on the current evidences: A puzzle with many missing pieces

In December 2019, a new type of coronavirus was detected for the first time in Wuhan, Hubei Province, China. According to the reported data, the emerging coronavirus has spread worldwide, infecting more than fifty-seven million individuals, leading to more than one million deaths. The current study aimed to review and discuss the hematological findings of COVID-19. Laboratory changes and hematologic abnormalities have been reported repeatedly in COVID-19 patients. WBC count and peripheral blood lymphocytes are normal or slightly reduced while these indicators may change with the progression of the disease. In addition, several studies demonstrated that decreased hemoglobin levels in COVID-19 patients were associated with the severity of the disease. Moreover, thrombocytopenia, which is reported in 5%-40% of patients, is known to be associated with poor prognosis of the disease. COVID-19 can present with various hematologic manifestations. In this regard, accurate evaluation of laboratory indicators at the beginning and during COVID-19 can help physicians to adjust appropriate treatment and provide special and prompt care for those in need.     

Doctors that “doctor” sickness certificates: cunning intelligence as an ability and possibly a virtue among Swedish GPs

Medicine, Health Care and Philosophy - The relations of power between healthcare-related institutions and the professionals that interact with them are changing. Generally, the institutions are...     

Assessment of heavy metals by ICP-OES and their impact on insulin stimulating hormone and carbohydrate metabolizing enzymes

Arsenic (As) and cadmium (Cd) have recently emerged as major health concerns owing to their strong association with diabetes mellitus (DM). We aimed to investigate the heavy metals exposure towards incidence of DM at various enzymatic and hormonal levels. Additionally, association of As and Cd with Zinc (Zn, essential metal) was also evaluated. Spot urine samples were collected to assess As, Cd and Zn through ICP-OES. Serum was analyzed by assay method for fasting blood glucose, liver and renal function biomarkers. ELISA was performed to investigate the impact of heavy metals on HbA1c, α-amylase, DPP-IV, IGF-1, leptin, GSH, MDA, SOD, HDL, FFA, TG and interleukin (IL)-6. Association of heavy metals with DM was measured by odds ratio (OR) and level of significance was assessed by Chi-squared test. Unpaired student's t-test was used to compare DM-associated risk factors in heavy metals-exposed and unexposed participants. As and Cd were detectable in 75.4% and 83% participants with mean concentration of 75.5 ppb and 54.5 ppb, respectively. For As exposure, OR in the third quartile was maximum ie 1.34 (95% CI, 0.80 to 2.23), however the result was not statistically significant (P > .05). For Cd exposure, OR in the fourth quartile was considerably high, 1.62 (95% CI, 1.00 to 2.61), with a significant probability value (P < .05). Urinary Cd was negatively associated with Zn. As and Cd exposure increases the incidence of DM in the general population. Impaired hormonal and enzymatic levels in diabetic and non-diabetic exposed participants reflect the multiple organ damage by heavy metal exposure.     

Impact of neurocognitive function on academic difficulties in pediatric bipolar disorder: A clinical translation.

BACKGROUND: Previous research has demonstrated that academic and neuropsychological functions are compromised in pediatric bipolar disorder (PBD). Investigation of the degree to which neuropsychological deficits might contribute to those academic problems is needed to aid in the recognition and intervention for school achievement difficulties in PBD. METHODS: A sample of 55 children and adolescents with PBD with and without attention-deficit/hyperactivity disorder (ADHD) (PBD group, n = 28; PBD+ADHD group, n = 27) were tested with a computerized neurocognitive battery and standardized neuropsychological tests. Age range of subjects was 7-17 years, with the mean age of 11.97 (3.18) years. Parents completed a structured questionnaire on school and academic functioning. RESULTS: Logistic regression analyses indicated that executive function, attention, working memory, and verbal memory scores were poorer in those with a history of reading/writing difficulties. A separate logistic regression analysis found that attentional dysfunction predicted math difficulties. These relationships between neuropsychological function and academic difficulties were not different in those with PBD+ADHD than in those with PBD alone. CONCLUSIONS: In PBD neuropsychological deficits in the areas of attention, working memory, and organization/problem solving skills all contribute to academic difficulties. Early identification and intervention for these difficulties might help prevent lower academic achievement in PBD.     

Primary adenocarcinoma of the appendix

Thirteen cases of primary appendicular adenocarcinoma are reported. This rare tumour usually presents as acute appendicitis. The correct diagnosis is rarely entertained before or during surgery. The main treatment choice lies between appendicectomy alone and appendicectomy followed by right hemicolectomy. There are anatomical reasons for advising the latter and survival figures from the literature tend to support this preference. The cases reported here indicate that in the period 1972-1984, in the North West Region, there was a slight preference for appendicectomy alone. The additional procedure of right hemicolectomy did not confer any clear-cut survival advantage.