Brachial artery hemodynamic response to acute converting enzyme inhibition by enalaprilat in essential hypertension

To assess the vascular involvement of renin-angiotensin system inhibition in human hypertension, acute effects of intravenous enalaprilat on brachial artery diameter, blood flow, and blood velocity were investigated in hypertensive patients by pulsed Doppler technique and compared with effects of saline vehicle. Compared with saline vehicle, enalaprilat reduced blood pressure (P less than 0.001) and increased brachial arterial diameter (P less than 0.01) and brachial blood flow (P less than 0.01). Enalaprilat effect on arterial pulse pressure was dependent on preinjection pulse pressure (r = -0.76; P less than 0.001), but its effect on mean blood pressure was not dependent on preinjection mean blood pressure. On the other hand, enalaprilat effect on arterial blood flow was negatively correlated with preinjection blood pressure (r = -0.64; P less than 0.02). The findings point to different responses of large and small arteries to intravenous enalaprilat.     

Detection of IgA class antibody to hepatitis E virus in serum samples from patients with hepatitis E virus infection

A newly developed assay for IgA class antibody to hepatitis E virus (IgA anti-HEV) was used to study 145 serum samples collected during an outbreak of an enterically transmitted hepatitis that occurred in 3 villages in the lower Shebeli region of Southern Somalia between January, 1988 and November, 1989. A total of 52.4% of the afflicted patients were found positive for IgA anti-HEV, and 73.1% of these were also positive for IgM. Both antibodies disappeared during the convalescence period. Similar results were also seen in serum obtained from sporadic cases of acute waterborne hepatitis in Pakistan. © 1993 Wiley-Liss, Inc.     

Evidence that [3H]-alpha,beta-methylene ATP may label an endothelial-derived cell line 5'-nucleotidase with high affinity.

1. In membranes prepared from a permanent cell line of endothelial origin (WEC cells), [3H]-alpha, beta-methylene ATP ([3H]-alpha, beta-meATP) labelled high (pKd = 9.5; Bmax = 3.75 pmol mg-1 protein) and low (pKd = 7.2; Bmax = 23.3 pmol mg-1 protein) affinity binding sites. The high affinity [3H]-alpha, beta-meATP binding sites in the WEC cell membranes could be selectively labelled with a low concentration of the radioligand (1 nM). In competition studies performed at a radioligand concentration of 1 nM, 88.6% of the sites possessed high affinity (pIC50 = 8.26) for alpha, beta-meATP. 2. The high affinity [3H]-alpha, beta-meATP binding sites appeared heterogeneous since in competition studies a number of nucleotide analogues (alpha, beta-meADP, ATP, ADP, AMP, GTP, GppNHp, GMP) and adenosine identified two populations of the sites labelled by 1 nM [3H]-alpha, beta-meATP. The proportion of sites with high affinity for these compounds was found to vary between 42 and 69%. 3. Approximately 60-69% of the binding sites labelled with 1 nM [3H]-alpha, beta-meATP possessed high affinity for alpha, beta-meADP (pIC50 = 8.87), AMP (pIC50 = 7.12), GMP (pIC50 = 7.34), UTP (pIC50 = 6.12), GTP (pIC50 = 7.59), GppNHp (pIC50 = 7.35) and adenosine (pIC50 = 5.45).(ABSTRACT TRUNCATED AT 250 WORDS)     

Analgesic profile of the sodium salt of pemedolac

Pemedolac Na, 1-ethyl-1,3,4,9-tetrahydro-4-(phenylmethyl)-pyrano [3,4-b] indole-1-acetic acid sodium salt, exhibited equipotent analgesic effects after oral, iv, and im administration, suggesting that it is well absorbed. In mouse writhing models, the ED₅₀ values ranged from 0.3 mg (0.81 μmol)/kg (vs. acetylcholine) to 4.3 mg (11.6 μmol)/kg (vs. paraphenylbenzoquinone [PBQ]). In the rat Randall-Selitto model, the ED₅₀ o the compound was approximately 0.001 mg (2.7 nmol)/kg, with a flat dose response curve. The peak effects lasted for 7–9 h, 10–18 h, and 5 h following oral, im, and iv injections, respectively. Intracerebroventricular (i.c.v.) injections of pemedolac Na inhibited the PBQ-induced writing in mice with an ED₅₀ of 43.5 μg (0.12 μmol)/mouse, and this effect was not antagonized by naloxone. It was inactive in the hot plate and tail flick tests, demonstrating that pemedolac Na does not act via an opiate mechanism. These results indicate that pemedolac Na is a viable parenteral and oral analgesic, typified by high analgesic potency, a rapid onset and long duration of action, and an extremely wide safety index. © Wiley-Liss, Inc.     

Paired kidney analysis of tacrolimus and cyclosporine microemulsion-based therapy in Chinese cadaveric renal transplant recipients

Few studies used paired kidneys for comparison between tacrolimus and cyclosporine in renal transplantation. Most of the published data used whole blood trough levels for drug monitoring. However, the use of limited sampling strategy and abbreviated formula to estimate the 12-h area under concentration-time curve (AUC(0-12)) allowed better prediction of drug exposure. Sixty-six first cadaveric renal transplant recipients receiving paired kidneys were randomized to receive either tacrolimus-based (n = 33) or cyclosporine microemulsion (Neoral)-based therapies (n = 33). Abbreviated AUC(0-12) was used for drug monitoring and dose titration. Mean follow-up duration was 2.8 +/- 2 years. The patient and graft survival were comparable. Fewer incidence of acute rejection was observed in tacrolimus group (15% vs. 27.3%) though the difference was not significant (P = 0.23). The absolute value and the rate of decline of creatinine clearance were both significantly better in tacrolimus-treated patients. Prevalence of hypertension, post-transplant diabetes mellitus, infection, and malignancy were similar in both groups. Prevalence of hypercholesterolemia (11/33 vs. 4/33) and gum hypertrophy (6/33 vs. 1/33) was more common in cyclosporine-treated patients (P = 0.04 in both parameters). This was the first prospective, randomized study with paired kidney analysis showing the renal function was significantly better in tacrolimus-treated patients than in cyclosporine-treated patients.     

44Sacral extracorporeal magnetic stimulation is an effective treatment for pelvic floor dyssynergia; Comparative study with biofeedback therapy

Background: Recent development of extracorporeal magnetic stimulation (ECMS) which uses current‐changing magnetic fields allows the induction of electrical stimulation in the desired deep tissue. Recent study showed the sacral nerve stimulation reduces corticoanal excitability that may play a functional role in anal continence mechanisms. Preliminary study shows that ECMS of sacral nerve can modify pelvic floor function and expel rectal balloon in patients with pelvic floor dyssynergia (PFD). Aims: To evaluate the effect of ECMS compared with biofeedback therapy (BF) in patients with PFD. Methods and Materials: Thirty‐eight patients who fulfilled Rome II criteria for PFD by colon transit time and anorectal function tests, were randomly treated with 8 sessions of ECMS (2/weeks; n = 19) at prone position or BF (2/weeks; n = 19) at sitting position. Stimulation parameters were set at 50–80% of maximum intensity, 10 and 50 Hz frequency, 3 s burst length with 3 and 6 s off using arm‐typed stimulator (BioCom‐1000, Mcube Co., Korea). Symptom scores for constipation with/without anorectal function test were repeatedly measured after each treatment. Response was defined as 50% or more decreased symptom score after treatment (partial response: 30–50%, poor: <30%). Results: Fifteen patients (age 49.1 ± 13.4 years, mean ± SD; 4 men) completed 8 session of BF and 14 patients (54.5 ± 17.6 years, 3 men) completed 8 session of ECMS. Four patients of BF group discontinued treatment due to unsatisfactory therapeutic effect (n = 1) and withdrew consent (n = 3) and 5 patients of ECMS group discontinued treatment because of same reasons (n = 1, 4). Total symptom scores were significantly decreased after treatment of 8 session in both treatment groups (13.4 ± 6.6 vs. 4.3 ± 4.0 for BF, p = 0.009; 14.9 ± 5.6 vs. 3.4 ± 4.0 for ECMS, p < 0.001). Bowel movements per week were also significantly increased after treatment in both groups (median 2 vs. 7 for BF, p = 0.035; median 2 vs. 7 for ECMS, p = 0.008). Thirteen out of 15 patients showed response in BF group and 12 out of 14 showed good response in ECMS group. No adverse effects in both groups. Conclusions: ECMS is as effective as BF for the treatment of PFD. Long‐term effect of ECMS for the patients with pelvic floor dyssynergia need to be evaluated in the near future.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

The effectiveness of sub-Tenon's infiltration of local anaesthesia for cataract surgery

Purpose: To determine if adequate anaesthesia and akinesia could be obtained using an inferonasal quadrant sub-Tenons anaesthesia for cataract surgery.
Methods: The sub-Tenons method of local anaesthesia was used in 50 patients undergoing extracapsular cataract extraction and lens implantation. The technique followed was that described by JD Stevens in his study of 50 patients. Posterior sub-Tenons space was approached through a conjunctival incision in the inferonasal quadrant and the anaesthetic solution delivered by an irrigating cannula. The patients were assessed for residual ocular movements just before surgery. Effectiveness of anaesthesia was assessed during surgery using a verbal pain rating score. Scoring was based on the concept of a visual analogue pain score chart.
Results: Total akinesia was obtained in 20% patients and total anaesthesia in 24% patients. The remainder of the patients had adequate akinesia and anaesthesia to proceed with and complete the surgery.
Conclusion: This method provides satisfactory anaesthesia for cataract surgery.