Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Acquired immunodeficiency syndrome (AIDS) is a serious disease that has special concern for the health care provider. AIDS has continued to grow despite control efforts. As the disease infectivity period remains lengthy, and the heterosexual population is affected to a greater degree, the level of anxiety has also risen despite educational endeavours. Many fears and anxieties have been associated with AIDS patients by health care workers. The reduction of stress, perceived risk and discomfort following educational efforts have been supported in past research. Educational programmes will need to be given for current health care workers at all levels as well as nursing students. Future nurses must be prepared to meet this challenge. This study was conducted using a convenience sample of nursing students at a university in western United States. Its purpose was to assess any changes that occurred in state anxiety following an educational presentation. Spielberge's State-Trait Anxiety Inventory was used as the measurement instrument. Some anxiety levels were significantly reduced. 相似文献
In this study, the emulsification-diffusion method traditionally used to prepare polymeric nanoparticles was adapted to obtain lipidic nanospheres (LN) using four model lipids. The method consists of dissolving the lipid in a partially water-miscible solvent (previously saturated with water) at room temperature or at controlled temperature depending on lipid solubility. This organic phase is emulsified in an aqueous solution of a stabilizing agent (saturated with solvent) by conventional stirring at the same temperature used to dissolve the lipid. This oil-in-water emulsion is then diluted with an excess of water at controlled temperature in order to provoke the diffusion from the internal phase into the external phase thereby causing lipid aggregation in the form of LN. This new approach for the preparation of LN has clear advantages over the existing methods, namely: (i) it is efficient and versatile; (ii) easy implementation and scaling up (with no need of high energy sources); (iii) high reproducibility and narrow size distribution; (iv) less physical stress (i.e., long exposure to high temperatures and to mechanical dispersion); (v) it is not necessary to dissolve the drug in the melted lipid. The selection of the water-miscible solvent and the stabilizers are critical parameters to obtain lipidic particles in the nanometric range. In general, solvents with high water miscibility and stabilizers able to form stable emulsions are preferred. The results demonstrated that it was possible to reduce the particle size by increasing the process temperature, the stirring rate, the amount of stabilizer, and by lowering the amount of lipid. Control of the preparative variables allowed to obtain LN with diameters under 100 nm. It was found that the influence of preparative parameters was associated with a mechanism based on a physicochemical instability. In this sense, it is suggested that the rapid solvent diffusion produces regions of local supersaturation near the interface, and LN are formed due to the ensuing interfacial phase transformations and lipid aggregation that occur in these interfacial domains. In terms of stability, only poly(vinyl alcohol) (PVAL) was able to preserve the physical stability of the dispersion for long periods after preparation. This effect was attributed to the ability of PVAL chains to form a strongly attached layer on the nanoparticle surface with an excellent repulsion effect. 相似文献
BackgroundPsoriasis is a chronic skin disease that can have severe psychosocial effects. The aim of this study was to assess the perspectives of psoriasis patients regarding their illness.MethodsOne hundred and ten psoriasis patients in the 18–65 age group were included. Data were collected via a “face to face interview” method. The questionnaire included mainly three topics (socio-demographic characteristics of patients; self-evaluations of patients about their disease; knowledge and attitudes about psoriasis).ResultsThe majority of the patients stated that psoriasis as a socially troubling disease. Almost half of them believed that “stress and unhappiness” was a predisposing factor of their illness. Belief that the occurrence of the disease was due to a contagious infectious agent was the second most frequent factor that patients emphasized. “Signs and symptoms of psoriasis” was the most frequent difficulty patients faced because of psoriasis. Most of the patients who still have their parents, those who have a closest friend in life, and more than half of the patients who have their closest friend at work all stated that there was a change in social relations, mostly arising from their counterparts. More than half of the married patients stated that there was a change in social relations, mostly arising from their spouses.ConclusionPsoriasis is more than a cosmetic nuisance and can be associated with psychosocial effects that seriously affect patients’ lives and social relations. Increasing the patients’ knowledge of the disease could have a positive effect on the relations the psoriasis patients have within their social environment. 相似文献
The purpose of this study was to examine oral health needs and dental care in individuals with trisomy 18 and trisomy 13 (full, mosaic, partial and other, mixed types). Primary feeding method was also examined. Data was collected from a parent‐completed, mixed method survey (TRIS Survey). Mean age in months was 120.2 (range 38 to 394 months) and 133 (range 36 to 405 months), respectively, for trisomy 18 and trisomy 13 individuals. Results indicated the majority of individuals received routine dental care from their family dentist. Approximately 80% in both groups needed some form of specialized dental care. Close to 25% and 30% of trisomy 18 and trisomy 13 individuals, respectively, required hospital admission for specialized dental care. Responses indicated the presence of excessive plaque and tooth decay across the groups with a higher incidence for individuals with trisomy 13. Although not the primary form of intake, over half of the individuals received oral feedings. Implications for dental care and management are provided along with the need for additional research to confirm or disconfirm this study's findings. 相似文献
We aimed to evaluate the role of two-dimensional speckle tracking imaging (2DSTI) in detecting early changes of myocardial deformation in patients affected by thalassemia major (TM) and its relation with myocardial iron overload (MIO) detected by T2* cardiovascular magnetic resonance (CMR). We studied 28 TM patients (15 males, 37.4?±?10 years). All patients underwent CMR and echocardiography in the same day. Segmental and global T2* values were measured. Values of global longitudinal strain (GLS) were derived from the three apical views, while radial and circumferential strain were obtained as average strain from the short axis views at basal, mid and apical level. Six patients (21.4%) showed significant MIO (global heart T2*?<?20 ms). GLS showed a significant correlation with T2* values (R?=??0.49; P?=?0.001) and it was significantly lower in patients with a significant MIO than in those with no significant MIO (?18.3?±?2 vs. ?21.3?±?2.7, P?=?0.02). No significant difference was found for radial and circumferential strain in relation to the severity of MIO. Patients with impaired GLS (<?19.5%) had a significant higher risk of showing significant MIO (Odds-ratio-OR?=?17; 95%). GLS is related with global T2* in TM patients. Moreover, GLS can identify TM patients with severe MIO detected by CMR. 相似文献