A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Fe3O4@Au core–shell hybrid nanocomposite for MRI-guided magnetic targeted photo-chemotherapy

Lasers in Medical Science - The combination of multiple therapeutic and diagnostic functions is fast becoming a key feature in the area of clinical oncology. The advent of nanotechnology promises...     

The effects of fructose intake on serum uric acid vary among controlled dietary trials

Hyperuricemia is linked to gout and features of metabolic syndrome. There is concern that dietary fructose may increase uric acid concentrations. To assess the effects of fructose on serum uric acid concentrations in people with and without diabetes, we conducted a systematic review and meta-analysis of controlled feeding trials. We searched MEDLINE, EMBASE, and the Cochrane Library for relevant trials (through August 19, 2011). Analyses included all controlled feeding trials ≥ 7 d investigating the effect of fructose feeding on uric acid under isocaloric conditions, where fructose was isocalorically exchanged with other carbohydrate, or hypercaloric conditions, and where a control diet was supplemented with excess energy from fructose. Data were aggregated by the generic inverse variance method using random effects models and expressed as mean difference (MD) with 95% CI. Heterogeneity was assessed by the Q statistic and quantified by I(2). A total of 21 trials in 425 participants met the eligibility criteria. Isocaloric exchange of fructose for other carbohydrate did not affect serum uric acid in diabetic and nondiabetic participants [MD = 0.56 μmol/L (95% CI: -6.62, 7.74)], with no evidence of inter-study heterogeneity. Hypercaloric supplementation of control diets with fructose (+35% excess energy) at extreme doses (213-219 g/d) significantly increased serum uric acid compared with the control diets alone in nondiabetic participants [MD = 31.0 mmol/L (95% CI: 15.4, 46.5)] with no evidence of heterogeneity. Confounding from excess energy cannot be ruled out in the hypercaloric trials. These analyses do not support a uric acid-increasing effect of isocaloric fructose intake in nondiabetic and diabetic participants. Hypercaloric fructose intake may, however, increase uric acid concentrations. The effect of the interaction of energy and fructose remains unclear. Larger, well-designed trials of fructose feeding at "real world" doses are needed.     

Effect of Replacing Animal Protein with Plant Protein on Glycemic Control in Diabetes: A Systematic Review and Meta-Analysis of Randomized Controlled Trials

Previous research on the effect of replacing sources of animal protein with plant protein on glycemic control has been inconsistent. We therefore conducted a systematic review and meta-analysis of randomized controlled trials (RCTs) to assess the effect of this replacement on glycemic control in individuals with diabetes. We searched MEDLINE, EMBASE, and Cochrane databases through 26 August 2015. We included RCTs ≥ 3-weeks comparing the effect of replacing animal with plant protein on HbA_1c, fasting glucose (FG), and fasting insulin (FI). Two independent reviewers extracted relevant data, assessed study quality and risk of bias. Data were pooled by the generic inverse variance method and expressed as mean differences (MD) with 95% confidence intervals (CIs). Heterogeneity was assessed (Cochran Q-statistic) and quantified (I²-statistic). Thirteen RCTs (n = 280) met the eligibility criteria. Diets emphasizing a replacement of animal with plant protein at a median level of ~35% of total protein per day significantly lowered HbA_1c (MD = −0.15%; 95%-CI: −0.26, −0.05%), FG (MD = −0.53 mmol/L; 95%-CI: −0.92, −0.13 mmol/L) and FI (MD = −10.09 pmol/L; 95%-CI: −17.31, −2.86 pmol/L) compared with control arms. Overall, the results indicate that replacing sources of animal with plant protein leads to modest improvements in glycemic control in individuals with diabetes. Owing to uncertainties in our analyses there is a need for larger, longer, higher quality trials. Trial Registration: ClinicalTrials.gov registration number: {"type":"clinical-trial","attrs":{"text":"NCT02037321","term_id":"NCT02037321"}}NCT02037321.     

Effect of fructose on blood pressure: a systematic review and meta-analysis of controlled feeding trials

Concerns have been raised about the adverse effect of fructose on blood pressure. International dietary guidelines, however, have not addressed fructose intake directly. A systematic review and meta-analysis was conducted to assess the effect of fructose in isocaloric exchange for other carbohydrates on systolic, diastolic, and mean arterial blood pressures. Studies were identified using Medline, Embase, and Cochrane databases (through January 9, 2012). Human clinical trials of isocaloric oral fructose exchange for other carbohydrate sources for ≥7 days were included in the analysis. Data were pooled by the generic inverse variance method using random-effects models and expressed as mean differences with 95% CI. Heterogeneity was assessed by the Q-statistic and quantified by I(2). Study quality was assessed using the Heyland Methodological Quality Score. Thirteen isocaloric (n=352) and 2 hypercaloric (n=24) trials met the eligibility criteria. Overall, fructose intake in isocaloric exchange for other carbohydrates significantly decreased diastolic (mean difference: -1.54 [95% CI: -2.77 to -0.32]) and mean arterial pressure (mean difference: -1.16 [95% CI: -2.15 to -0.18]). There was no significant effect of fructose on systolic blood pressure (mean difference: -1.10 [95% CI: -2.46 to 0.44]). The hypercaloric fructose feeding trials found no significant overall mean arterial blood pressure effect of fructose in comparison with other carbohydrates. To confirm these results, longer and larger trials are needed. Contrary to previous concerns, we found that isocaloric substitution of fructose for other carbohydrates did not adversely affect blood pressure in humans.     

The efficacy of magnesium sulfate loading on microalbuminuria following SIRS: One step forward in dosing

Backgrounds

Magnesium has been known for its antioxidative and antiinflammatory properties in many studies. In this study two dosing regimens of magnesium were compared with a placebo control group in order to investigate safety and efficacy of high doses of intravenous magnesium sulfate infusion on critically ill trauma patients. Inflammatory and oxidative factors were measured in this trial.

Methods

45 trauma patients with systemic inflammatory response syndromes (SIRS) were randomly assigned into 2 treatment and one placebo groups. The high dose group received 15 g MgSO₄, low dose group received 7.5 g of MgSO₄ over 4 hour infusion, and placebo group received saline alone. The initial and post magnesium sulfate injections levels of tumor necrosis factor alpha (TNF-α), total antioxidant power and lipid peroxidation were measured after 6, 18 and 36 hours. The pre-infusion along with 6 and 36 hour level of microalbuminuria were also determined.

Results

Repeated measurements illustrated that there was no significant difference in TNF-α, total antioxidant power and lipid peroxidation levels among groups during the period of analysis. The microalbuminuria at 36 hour post infusion of high dose group was lower than that of control group (p = 0.024). Patient’s mortality (28 day) was similar among all treatment groups. Both magnesium infusion groups tolerated the drug without experiencing any complications.

Conclusion

No evidence for antioxidative and antiinflammatory effects of magnesium in traumatic SIRS positive patients was found. Magnesium in high doses may be recommended for traumatic patients with SIRS status to prevent microalbuminuria.     

Effect of fructose on postprandial triglycerides: A systematic review and meta-analysis of controlled feeding trials

Background

In the absence of consistent clinical evidence, concerns have been raised that fructose raises postprandial triglycerides.

Purpose

A systematic review and meta-analysis was conducted to assess the effect of fructose on postprandial triglycerides.

Data sources

Relevant studies were identified from MEDLINE, EMBASE, and Cochrane databases (through September 3, 2013).

Data selection

Relevant clinical trials of ≥7-days were included in the analysis.

Data extraction

Two independent reviewers extracted relevant data with disagreements reconciled by consensus. The Heyland Methodological Quality Score (MQS) assessed study quality. Data were pooled by the generic inverse variance method using random effects models and expressed as standardized mean differences (SMD) with 95% confidence intervals (CI). Heterogeneity was assessed (Cochran Q statistic) and quantified (I² statistic).

Data synthesis

Eligibility criteria were met by 14 isocaloric trials (n = 290), in which fructose was exchanged isocalorically for other carbohydrate in the diet, and two hypercaloric trials (n = 33), in which fructose supplemented the background diet with excess energy from high-dose fructose compared with the background diet alone (without the excess energy). There was no significant effect in the isocaloric trials (SMD: 0.14 [95% CI: −0.02, 0.30]) with evidence of considerable heterogeneity explained by a single trial. Hypercaloric trials, however, showed a significant postprandial triglyceride raising-effect of fructose (SMD: 0.65 [95% CI: 0.30, 1.01]).

Limitations

Most of the available trials were small, short, and of poor quality. Interpretation of the isocaloric trials is complicated by the large influence of a single trial.

Conclusions

Pooled analyses show that fructose in isocaloric exchange for other carbohydrate does not increase postprandial triglycerides, although an effect cannot be excluded under all conditions. Fructose providing excess energy does increase postprandial triglycerides. Larger, longer, and higher-quality trials are needed.

Protocol registration

ClinicalTrials.gov identifier, NCT01363791.