CD19 + CD21lo/neg cells are increased in systemic sclerosis-associated interstitial lung disease

Interstitial lung disease (ILD) represents a significant cause of morbidity and mortality in systemic sclerosis (SSc). The purpose of this study was to examine recirculating lymphocytes from SSc patients for potential biomarkers of interstitial lung disease (ILD). Peripheral blood mononuclear cells (PBMCs) were isolated from patients with SSc and healthy controls enrolled in the Vanderbilt University Myositis and Scleroderma Treatment Initiative Center cohort between 9/2017–6/2019. Clinical phenotyping was performed by chart abstraction. Immunophenotyping was performed using both mass cytometry and fluorescence cytometry combined with t-distributed stochastic neighbor embedding analysis and traditional biaxial gating. This study included 34 patients with SSc-ILD, 14 patients without SSc-ILD, and 25 healthy controls. CD21^lo/neg cells are significantly increased in SSc-ILD but not in SSc without ILD (15.4 ± 13.3% vs. 5.8 ± 0.9%, p = 0.002) or healthy controls (5.0 ± 0.5%, p < 0.0001). While CD21^lo/neg B cells can be identified from a single biaxial gate, tSNE analysis reveals that the biaxial gate is comprised of multiple distinct subsets, all of which are increased in SSc-ILD. CD21^lo/neg cells in both healthy controls and SSc-ILD are predominantly tBET positive and do not have intracellular CD21. Immunohistochemistry staining demonstrated that CD21^lo/neg B cells diffusely infiltrate the lung parenchyma of an SSc-ILD patient. Additional work is needed to validate this biomarker in larger cohorts and longitudinal studies and to understand the role of these cells in SSc-ILD.

     

COVID-19 Gender Disparities and Mitigation Recommendations: A Narrative Review

The coronavirus disease 2019 (COVID-19) pandemic has rapidly created widespread impacts on global health and the economy. Data suggest that women are less susceptible to severe illness. However, sex-disaggregated data are incomplete, leaving room for misinterpretation, and focusing only on biologic sex underestimates the gendered impact of the pandemic on women. This narrative review summarizes what is known about gender disparities during the COVID-19 pandemic and the economic, domestic, and health burdens along with overlapping vulnerabilities related to the pandemic. In addition, this review outlines recommended strategies that advocacy groups, community leaders, and policymakers should implement to mitigate the widening gender disparities related to COVID-19.     

Hip Displacement in Cerebral Palsy: The Role of Surveillance

IntroductionHip displacement is common in cerebral palsy (CP) and is related to the severity of neurological and functional impairment. It is a silent, but progressive disease, and can result in significant morbidity and decreased quality of life, if left untreated. The pathophysiology of hip displacement in CP is a combination of hip flexor-adductor muscle spasticity, abductor muscle weakness, and delayed weight-bearing, resulting in proximal femoral deformities and progressive acetabular dysplasia. Due to a lack of symptoms in the early stages of hip displacement, the diagnosis is easily missed. Awareness of this condition and regular surveillance by clinical examination and serial radiographs of the hips are the key to early diagnosis and treatment.Hip surveillance programmesSeveral population-based studies from around the world have demonstrated that universal hip surveillance in children with CP allows early detection of hip displacement and appropriate early intervention, with a resultant decrease in painful dislocations. Global hip surveillance models are based upon the patients’ age, functional level determined by the Gross Motor Function Classification system (GMFCS), gait classification, standardized clinical exam, and radiographic indices such as the migration percentage (MP), as critical indicators of progressive hip displacement.ConclusionDespite 25 years of evidence showing the efficacy of established hip surveillance programmes, there is poor awareness among healthcare professionals in India about the importance of regular hip surveillance in children with CP. There is a need for professional organizations to develop evidence-based guidelines for hip surveillance which are relevant to the Indian context.     

Emerging therapeutic options in inflammatory bowel disease

Inflammatory bowel disease (IBD) is a chronic disease that requires chronic treatment throughout the evolution of the disease, with a complex physiopathology that entails great challenges for the development of new and specific treatments for ulcerative colitis and Crohn´s disease. The anti-tumor necrosis factor alpha therapy has impacted the clinical course of IBD in those patients who do not respond to conventional treatment, so there is a need to develop new therapies and markers of treatment response. Various pathways involved in the development of the disease are known and the new therapies have focused on blocking the inflammatory process at the gastrointestinal level by oral, intravenous, subcutaneous, and topical route. All these new therapies can lead to more personalized treatments with higher success rates and fewer relapses. These treatments have not only focused on clinical remission, but also on achieving macroscopic changes at the endoscopic level and microscopic changes by achieving mucosal healing. These treatments are mainly based on modifying signaling pathways, by blocking receptors or ligands, reducing cell migration and maintaining the integrity of the epithelial barrier. Therefore, this review presents the efficacy and safety of the new treatments that are currently under study and the advances that have been made in this area in recent years.     

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.