A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Individual differences in anthropomorphic attributions and human brain structure

Anthropomorphism is the attribution of human characteristics or behaviour to animals, non-living things or natural phenomena. It is pervasive among humans, yet nonetheless exhibits a high degree of inter-individual variability. We hypothesized that brain areas associated with anthropomorphic thinking might be similar to those engaged in the attribution of mental states to other humans, the so-called ‘theory of mind’ or mentalizing network. To test this hypothesis, we related brain structure measured using magnetic resonance imaging in a sample of 83 healthy young adults to a simple, self-report questionnaire that measured the extent to which our participants made anthropomorphic attributions about non-human animals and non-animal stimuli. We found that individual differences in anthropomorphism for non-human animals correlated with the grey matter volume of the left temporoparietal junction, a brain area involved in mentalizing. Our data support previous work indicating a link between areas of the brain involved in attributing mental states to other humans and those involved in anthropomorphism.     

Effects of diet on the management of struvite uroliths in dogs and cats

Results of experimental and clinical investigations have confirmed the importance of dietary modifications in medical protocols designed to promote dissolution and prevention of some kinds of uroliths. Change in the composition of dietary ingredients is one example of a method to reduce the quantity of lithogenic crystalloids in urine. The current study shows evidence of the positive effects of one of the commercial therapeutic foods on improvement of struvite urolithiasis, in different cases of cats and dogs performed at Kiev University, Ukraine.     

Liver transplantation as a definitive treatment for familial hypercholesterolemia: A series of 36 cases

FH is a genetic disorder characterized by an increase in serum LDL and total cholesterol values. The afflicted patients are at increased risk of premature atherosclerosis and myocardial infarction. Different treatment modalities are present, including pharmacological agents and surgical procedures. The most effective method of therapy in refractive cases is liver transplantation. Herein, we report our experience on 36 cases of patients with FH undergoing liver transplantation in our center, the main referral center of liver transplantation in Iran. The clinical findings, hospital courses, post‐operative complications, and patient follow‐up are also described.     

Drug-induced bone loss: a major safety concern in Europe

Introduction: Drug-induced bone loss remains the major cause of vertebral and hip fractures and significantly associated to morbidity and mortality. This article will review the common drugs identified as the causes of bone loss and the risk factors and management in European countries.

Areas covered: Beyond glucorticoid – the most cause of osteoporosis, many different drugs could cause harmful skeletal disorders. The antiepileptics, hormonal therapy, GnRH antagonists, aromatase inhibitors are well-known cause of bone loss. Osteoporosis and fractures risk also increased with calcineurin inhibitors, antiretroviral drugs, selective inhibitors of serotonin reuptake, loop diuretics, heparins, oral anticoagulants, high doses of thyroxine and proton pump inhibitors.

Expert opinion: Drugs are an important secondary cause of osteoporosis. Healthcare professionals should reassess the requirement for drugs and use the lowest dosage and shortest duration. Lifestyle changes, adequate calcium, vitamin D supplement, appropriate monitoring of bone status and initiating osteoporosis treatment if indicated are recommended when drugs having potential deleterious effects on bone are used, particularly in high risk patients. The update and further studies would provide concluded evidences of controversial drugs induced bone loss and determine the best prevention and treatment strategies.     

Fe3O4@Au core–shell hybrid nanocomposite for MRI-guided magnetic targeted photo-chemotherapy

Lasers in Medical Science - The combination of multiple therapeutic and diagnostic functions is fast becoming a key feature in the area of clinical oncology. The advent of nanotechnology promises...     

Results of liver transplantation: analysis of 140 cases at a single center

The Shiraz Organ Transplant Center in southern Iran has been performing all liver transplantations in Iran and certain neighboring countries for 12 years. This study evaluated the 140 operations performed from April 1993 through November 2004. Sixty-one percent of the recipients were men and 39% were women. The average recipient age was 29.9 +/- 14.0 years. One hundred twenty-eight patients has a full-size cadaveric transplant. Most frequent causes of cirrhosis were cryptogenic and viral. An acute rejection episode occurred in 47.5% of cases, and two episodes in 8%. Most frequent short-term complications included respiratory, neurologic, and biliary problems. The 1-, 2-, and 3-year patient survival rates were 92%, 89%, and 85%, respectively. The experience that the Shiraz Organ Transplant Center has had with liver transplantation indicated success comparable to that noted in other reports. The calculated trend suggests that a goal of 100 transplantations for 2005 is within reach.     

Extraperitoneal laparoscopic lymph node staging: the University of Southern California experience

OBJECTIVES: To describe our experience with extraperitoneal lymph node staging in gynecologic oncology. MATERIALS AND METHODS: The extraperitoneal approach was performed to assess the lymph node histology in patients with gynecologic malignancies. The nodes are approached from a lateral approach after dissecting open the extraperitoneal space bluntly and with insufflation. Bilateral aortic nodes are taken from a left-sided or right-sided approach depending on the patient's characteristics. RESULTS: Forty-six patients underwent this procedure over a 2.5-year period. Thirty-seven patients had cervical cancer. The median BMI was 27.1 (17.7-38.1). The median lymph node yield was 14 (0-60). Two patients had disruption of the peritoneum such that the aortic lymphadenectomy had to be completed transperitoneally. No patients required laparotomy. No patients required transfusion. DISCUSSION: This technique permits histologic evaluation of the retroperitoneal nodes with minimal risk of intraabdominal adhesions. Recovery is rapid and further therapy can be prescribed shortly. The data on the nodes can assist in treatment planning.