Überregionale Public-Health-Akteure in Deutschland – eine Bestandsaufnahme und Kategorisierung

Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz - Akteure der öffentlichen Gesundheit (Public Health) tragen wesentlich zu Gesundheitsschutz, -förderung und...     

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Estimation of phase signal change in neuronal current MRI for evoke response of tactile detection with realistic somatosensory laminar network model

Magnetic field generated by neuronal activity could alter magnetic resonance imaging (MRI) signals but detection of such signal is under debate. Previous researches proposed that magnitude signal change is below current detectable level, but phase signal change (PSC) may be measurable with current MRI systems. Optimal imaging parameters like echo time, voxel size and external field direction, could increase the probability of detection of this small signal change. We simulate a voxel of cortical column to determine effect of such parameters on PSC signal. We extended a laminar network model for somatosensory cortex to find neuronal current in each segment of pyramidal neurons (PN). 60,000 PNs of simulated network were positioned randomly in a voxel. Biot–savart law applied to calculate neuronal magnetic field and additional phase. The procedure repeated for eleven neuronal arrangements in the voxel. PSC signal variation with the echo time and voxel size was assessed. The simulated results show that PSC signal increases with echo time, especially 100/80 ms after stimulus for gradient echo/spin echo sequence. It can be up to 0.1 mrad for echo time = 175 ms and voxel size = 1.48 × 1.48 × 2.18 mm³. With echo time less than 25 ms after stimulus, it was just acquired effects of physiological noise on PSC signal. The absolute value of the signal increased with decrease of voxel size, but its components had complex variation. External field orthogonal to local surface of cortex maximizes the signal. Expected PSC signal for tactile detection in the somatosensory cortex increase with echo time and have no oscillation.     

Subcutaneous immunization with a novel immunogenic candidate (urease) confers protection against Brucella abortus and Brucella melitensis infections

Brucellosis is a world prevalent endemic illness that is transmitted from domestic animals to humans. Brucella spp. exploits urease for survival in the harsh conditions of stomach during the gastrointestinal infection. In this study, we examined the immune response and the protection elicited by using recombinant Brucella urease (rUrease) vaccination in BALB/c mice. The urease gene was cloned in pET28a and the resulting recombinant protein was employed as subunit vaccine. Recombinant protein was administered subcutaneously and intraperitoneally. Dosage reduction was observed with subcutaneous (SC) vaccination when compared with intraperitoneal (IP) vaccination. rUrease induced mixed Th1–Th2 immune responses with high titers of specific IgG1 and IgG2a. In lymphocyte proliferation assay, splenocytes from IP and SC‐vaccinated mice displayed a strong recall proliferative response with high amounts of IL‐4, IL‐12 and IFN‐γ production. Vaccinated mice were challenged with virulent Brucella melitensis, B. abortus and B. suis. The SC vaccination route exhibited a higher degree of protection than IP vaccination (p value ≤ 0.05). Altogether, our results indicated that rUrease could be a useful antigen candidate for the development of subunit vaccines against brucellosis.     

COVID-19 and hematology findings based on the current evidences: A puzzle with many missing pieces

In December 2019, a new type of coronavirus was detected for the first time in Wuhan, Hubei Province, China. According to the reported data, the emerging coronavirus has spread worldwide, infecting more than fifty-seven million individuals, leading to more than one million deaths. The current study aimed to review and discuss the hematological findings of COVID-19. Laboratory changes and hematologic abnormalities have been reported repeatedly in COVID-19 patients. WBC count and peripheral blood lymphocytes are normal or slightly reduced while these indicators may change with the progression of the disease. In addition, several studies demonstrated that decreased hemoglobin levels in COVID-19 patients were associated with the severity of the disease. Moreover, thrombocytopenia, which is reported in 5%-40% of patients, is known to be associated with poor prognosis of the disease. COVID-19 can present with various hematologic manifestations. In this regard, accurate evaluation of laboratory indicators at the beginning and during COVID-19 can help physicians to adjust appropriate treatment and provide special and prompt care for those in need.