Effectiveness,Patient Satisfaction,and Cost Reduction of Virtual Joint Replacement Clinic Follow-Up of Hip and Knee Arthroplasty

BackgroundTotal hip and knee arthroplasties are increasingly performed operations, and routine follow-up places huge demands on orthopedic services. This study investigates the effectiveness, patients’ satisfaction, and cost reduction of Virtual Joint Replacement Clinic (VJRC) follow-up of total hip arthroplasty and total knee arthroplasty patients in a university hospital. VJRC is especially valuable when in-person appointments are not advised or feasible such as during the COVID-19 pandemic.MethodsA total of 1749 patients who were invited for VJRC follow-up for knee or hip arthroplasty from January 2017 to December 2018 were included in this retrospective study. Patients were referred to VJRC after their 6-week postoperative review. Routine VJRC postoperative review was undertaken at 1 and 7 years and then 3-yearly thereafter. We evaluated the VJRC patient response rate, acceptability, and outcome. Patient satisfaction was measured in a subgroup of patients using a satisfaction survey. VJRC costs were calculated compared to face-to-face follow-up.ResultsThe VJRC had a 92.05% overall response rate. Only 7.22% required further in-person appointments with only 3% being reviewed by an orthopedic consultant. VJRC resulted in an estimated saving of £42,644 per year at our institution. The patients’ satisfaction survey showed that 89.29% of the patients were either satisfied or very satisfied with VJRC follow-up.ConclusionVJRC follow-up for hip and knee arthroplasty patients is an effective alternative to in-person clinic assessment which is accepted by patients, has high patient satisfaction, and can reduce the cost to both health services and patients.     

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

The Transmission of Trauma from Mother to Infant: Radioactive Residues and Counter-Transference in the Case of a Haitian Mother and Her Two-Year-Old Son*

ABSTRACT

Close observation of the interactions between a traumatised mother and her infant son provides information on the modes of transmission of psychic trauma in the mother–infant dyad. Following the presentation of a current literature review on the theme, the subject of “radioactive residue” and counter-transference in the transmission of psychic trauma from mother to infant will be illustrated through a clinical case study that focuses on a Haitian mother and her two-year-old infant son who has been referred to a “transitional care nursery” in urban Paris. The encounter with this mother–infant dyad is analysed through observing the quality of the interactions that take place between the mother and infant in order to determine how a particularly traumatic narrative impacts the mother–infant relationship, in addition to relations with the clinician. Mother and infant respond to one another through the emission and reception of “radioactive residues” as hypothesized by Gampel. This clinical case study shows that there is a need to consider transcultural factors and collective experience and history when analysing traumatic events. Additionally, the case study shows that counter-transference can be an effective clinical tool for gaining access to an infant's experience as the recipient of a traumatic narrative.     

Tobacco consumption,opium use,alcohol drinking and the risk of esophageal cancer in North Khorasan,Iran

Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.

Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.

Results: Our findings show Hookah smoking [OR = 6.1(CI_95%:1.2–13.1)] and opium consumption [OR = 2.1(CI_95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.

Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district.     

Identification of the medial femoral safe zone for drilling during dynamic hip screw side plate fixation: A CT angiogram tracing of the profunda femoris artery

Objectives

Iatrogenic injury of the Profunda Femoris Artery (PFA) at time of hip fixation surgery can increase morbidity and mortality and prolong the hospital stay. This is an injury that tends to pass unnoticed as a cause of postoperative deterioration despite being frequently reported in the literature. Our study aims to describe the anatomy of the PFA in relation to the medial femoral cortex with specific emphasis on its orientation relative to the position of a sliding hip screw side plate construct. By doing so we are able to present clear guidance to orthopaedic surgeons on how to avoid iatrogenic PFA injury at the time of hip fracture fixation.

Safety profile of the adjuvanted recombinant zoster vaccine: Pooled analysis of two large randomised phase 3 trials

Background

The ZOE-50 (NCT01165177) and ZOE-70 (NCT01165229) phase 3 clinical trials showed that the adjuvanted recombinant zoster vaccine (RZV) was ≥90% efficacious in preventing herpes zoster in adults. Here we present a comprehensive overview of the safety data from these studies.