Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The presence of nanoparticles in the environment and their impact on existing organisms is one of the main concerns of researchers working in this field. In this research, Nd2WO6 nanoparticles were prepared by an ultrasonic procedure for the first time. X-ray powder diffraction (XRD), Fourier-transform infrared spectroscopy (FT-IR), and energy-dispersive X-ray spectroscopy (EDS) analyses were applied to identify and prove the purity of these particles. In addition to increasing the reaction rate and efficiency with the help of a radical generation mechanism, ultrasound was able to aid the synthesis of these particles. After confirming nanoparticle formation, the optimal nanoparticles in view of scale and morphology were selected by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Optimal particles at three concentrations (25, 50, and 100 ppm) were mixed into the algae growth medium to investigate the effects of the nanoparticles on Dunaliella salina growth. Biological parameters, including the number of cells, biomass, specific growth rate, pigments, and malondialdehyde (MDA), were measured after ten days. Growth parameters showed an increasing trend in concentrations up to 50 ppm; however, at a concentration of 100 ppm, a significant decrease was observed in contrast to the nanoparticles-free treatment. The MDA content showed a linear relationship with enhanced concentration of the nanoparticles. The examination of biological parameters showed that the algae response to stress was dependent on the concentration of nanoparticles. The results showed that 50 ppm of nanoparticles are suitable for increasing algae and achieving a suitable growth rate for commercial purposes. However, in higher concentrations, algal growth inhibition occurs, which is of great importance from a biotechnological point of view.In this work, Nd2WO6 nanoparticles were synthesized by the ultrasonic method for the first time. Also, for the first time, the impact of these nanoparticles on the environment was investigated.相似文献
Objective:compare the habits and features of obese (BMI〉25) and normal (BMI〈25) individuals and express a method to ameliorate the life styles using a cross-sectional experiment. Methods:A total of 220 randomly selected cases were divided into case group (n= 110) and control group (n= 100) according to the calculated BMI level. Samples with BMI〉25 kg/m^2 were assigned to the case (obsess) group and those with BMI ranging from 20 to 25 were assigned to control (normal) group. The Miller-Smith life style questionnaires consisting 20 questions each with 5 different answers were given to both groups. Data of the questionnaires were collected and analyzed using t-test and Chi-square with SPSS. Results:No significant differences were found among the two groups in terms of the mean age, gender, level of education, marital status, insurance, breakfast, lunch or dinner, fried meat, legumes, eaffeinated beverages, the length of sleep during 24 h, cigarette smoking and losing job or spouse. However, in regards to use of vegetables, sausage, fried potatoes, enriched breads, low fat milk, low salt, candies and chocolates significant relations were found (P〈0.05). Conclusion: The present study suggests one way to control obesity and prevent diseases is to ameliorate the life styles. There is a relation between health and stress and irregularity of meals, such as breakfast skipping, is associated with overweight and obesity in adolescence. 相似文献
Objective: To explore how relaxation reduce the effect of stress in Iranian nursing students. Methods: A total of 40 nursing students were randomly selected and divided into two groups of test and control each with 20 students. An exam questionnaire consisting of the stress test of Spilberger and control of physiological determinants (blood pressure, pulse respiration, temperature) was performed to two groups. The practice of relaxation continued for two weeks and three times a day. Data were collected and analysed using t-test and Chi-square. Results: Two groups did not show any difference in relation to the average of physiological determinants before and after investigation. However, pulse was significantly different between the two groups. The average scores of stress before and after relaxation were significantly differed between the two groups investigation so that the level of stress was reduced in the test group (t= 2.5, df =39, P= 0.02). Conclusion: To alleviate stressors associated with clinical practice and create a healthy work environment for practice it is recommended that nursing students have some relaxation before entering practical environments. 相似文献
The transmission of malaria by blood transfusion was one of the first transfusion-transmitted infections recorded in the world.
Transfusion-transmitted malaria may lead to serious problems because infection with Plasmodium falciparum may cause rapidly fatal death. This study aimed to compare real-time polymerase chain reaction (real-time PCR) with rapid
diagnostic test (RDT) and light microscopy for the detection of Plasmodium spp. in blood transfusion, both in endemic and non-endemic areas of malaria disease in Iran. Two sets of 50 blood samples
were randomly collected. One set was taken from blood samples donated in blood bank of Bandar Abbas, a city located in a malarious-endemic
area, and the other set from Tehran, a non-endemic one. Light microscopic examination on both thin and thick smears, RDTs,
and real-time PCR were performed on the blood samples and the results were compared. Thin and thick light microscopic examinations
of all samples as well as RDT results were negative for Plasmodium spp. Two blood samples from endemic area were positive only with real-time PCR. It seems that real-time PCR as a highly sensitive
method can be helpful for the confirmation of malaria infection in different units of blood transfusion organization especially
in malaria-endemic areas where the majority of donors may be potentially infected with malaria parasites. 相似文献
Objective: To identify factors related to quality of life in post myocardial infarction patients. Methods: The subjects were 150 post myocardial infarction patients who were receiving follow up care at Hajar Hospital. Self-administered questionnaires consisting of physical-and mental health-quality of life (QoL) during a 14-month follow-up were designed. A X2 test was used to determine relationships between variables. Results: There was significant corretation between demographic variables such as insurance and retirees between the subjects tested. In addition, a significant relationship between the pain intensity, fatigue, reducing or losing job performance and QoL was found. Conclusion : The role of nurses to fulfill all social, psychotically and mental requirements of the patients with myocardial infarction is highly appreciated. 相似文献
The mouse lymphoma (L5178Y tk³/ 3.7.2C) in vitromuta-genesis assay can measure the genotoxic effects of a widevariety of chemical agents by inactivation of a single functionalthymidine kinase (tk-1) gene. We have previously demonstrated,using cytogenetic and molecular techniques, that the types ofmolecular lesions associated with tk-1 gene inactivation spana wide range similar to that seen in tumor cells at specificoncogene and tumor suppressor gene loci. We have identified,using polymerase chain reaction techniques, 21 microsatellite,or simple sequence repeat, polymorphisms betweenchromosomes 11a and 11b in 3.7.2C cells. These microsatellitepolymorphisms span virtually the entire chromosome, from mappingpositions of 378 centiMorgans (cM) from the centromere,thus providing landmarks to study loss of genetic material acrossthe entire chromosome. Four of the microsatellite polymorphismslie within 12 cM of tk-1, and provide a means of mapping lossof genetic material in the immediate vicinity of tk-1, a capabilitythat we have not previously had in the mouse lymphoma assay.Loss of alleles (i. e. loss of heterozygosity) is an importantfeature of tumor development, having to do with tumor suppressorgene expression. Therefore, the ability to detect loss of heterozygosityin the mouse lymphoma assay will make the assay an extremelyvaluable tool in the detection of agents capable of inducingloss of heterozygosity.
3To whom correspondence should be addressed 相似文献