Evidence that [3H]-alpha,beta-methylene ATP may label an endothelial-derived cell line 5'-nucleotidase with high affinity.

1. In membranes prepared from a permanent cell line of endothelial origin (WEC cells), [3H]-alpha, beta-methylene ATP ([3H]-alpha, beta-meATP) labelled high (pKd = 9.5; Bmax = 3.75 pmol mg-1 protein) and low (pKd = 7.2; Bmax = 23.3 pmol mg-1 protein) affinity binding sites. The high affinity [3H]-alpha, beta-meATP binding sites in the WEC cell membranes could be selectively labelled with a low concentration of the radioligand (1 nM). In competition studies performed at a radioligand concentration of 1 nM, 88.6% of the sites possessed high affinity (pIC50 = 8.26) for alpha, beta-meATP. 2. The high affinity [3H]-alpha, beta-meATP binding sites appeared heterogeneous since in competition studies a number of nucleotide analogues (alpha, beta-meADP, ATP, ADP, AMP, GTP, GppNHp, GMP) and adenosine identified two populations of the sites labelled by 1 nM [3H]-alpha, beta-meATP. The proportion of sites with high affinity for these compounds was found to vary between 42 and 69%. 3. Approximately 60-69% of the binding sites labelled with 1 nM [3H]-alpha, beta-meATP possessed high affinity for alpha, beta-meADP (pIC50 = 8.87), AMP (pIC50 = 7.12), GMP (pIC50 = 7.34), UTP (pIC50 = 6.12), GTP (pIC50 = 7.59), GppNHp (pIC50 = 7.35) and adenosine (pIC50 = 5.45).(ABSTRACT TRUNCATED AT 250 WORDS)     

Analgesic profile of the sodium salt of pemedolac

Pemedolac Na, 1-ethyl-1,3,4,9-tetrahydro-4-(phenylmethyl)-pyrano [3,4-b] indole-1-acetic acid sodium salt, exhibited equipotent analgesic effects after oral, iv, and im administration, suggesting that it is well absorbed. In mouse writhing models, the ED₅₀ values ranged from 0.3 mg (0.81 μmol)/kg (vs. acetylcholine) to 4.3 mg (11.6 μmol)/kg (vs. paraphenylbenzoquinone [PBQ]). In the rat Randall-Selitto model, the ED₅₀ o the compound was approximately 0.001 mg (2.7 nmol)/kg, with a flat dose response curve. The peak effects lasted for 7–9 h, 10–18 h, and 5 h following oral, im, and iv injections, respectively. Intracerebroventricular (i.c.v.) injections of pemedolac Na inhibited the PBQ-induced writing in mice with an ED₅₀ of 43.5 μg (0.12 μmol)/mouse, and this effect was not antagonized by naloxone. It was inactive in the hot plate and tail flick tests, demonstrating that pemedolac Na does not act via an opiate mechanism. These results indicate that pemedolac Na is a viable parenteral and oral analgesic, typified by high analgesic potency, a rapid onset and long duration of action, and an extremely wide safety index. © Wiley-Liss, Inc.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Ongoing and stimulus-evoked activity of sympathetically correlated neurons in the intermediate zone and dorsal horn of acutely spinalized rats

We have shown previously that in the acutely spinalized anesthetized rat the activities of many dorsal horn interneurons (DHN) at the T(10) level are correlated positively with both ongoing and stimulus-evoked renal sympathetic nerve activity (RSNA) and therefore may belong to networks generating RSNA after acute, cervical, spinal transection. In the present study, we recorded from both DHN and interneurons in the intermediate zone (IZN) of the T(10) spinal segment in acutely C(1)-transected, chloralose-anesthetized, artificially respired rats. The activities of a similar percentage of IZN and DHN were correlated positively with ongoing RSNA, but the peaks of spike-triggered averages of RSNA based on the activity of IZN were larger, relative to dummy averages, than spike-triggered averages of RSNA based on the activity of DHN. Sympathetically correlated DHN and IZN differed in their responses to noxious somatic stimuli. Most correlated DHN had relatively simple somatic fields; they were excited by noxious stimulation of the T(10) and nearby dermatomes and inhibited by stimulation of more distal dermatomes. As we have shown previously, the excitatory and inhibitory fields of these neurons were very similar to fields that, respectively, excited and inhibited RSNA. On the other hand, the somatic fields of 50% of sympathetically correlated IZN were significantly more complex, indicating a difference between either the inputs or the processing properties of IZN and DHN. Sympathetically correlated IZN and DHN also differed in their responses to colorectal distension (CRD), a noxious visceral stimulus. CRD increased RSNA in 11/15 rats and increased the activity of most sympathetically correlated T(10) IZN. On the other hand, CRD decreased the activity of a majority of sympathetically correlated T(10) DHN. These observations suggest that the same stimulus may differentially affect separate, putative, sympathoexcitatory pathways, exciting one and inhibiting the other. Thus the magnitude and even the polarity of responses to a given stimulus may be determined by the modality and location of the stimulus, the degree to which multiple pathways are affected by the stimulus, and the ongoing activity of presympathetic neurons, at multiple rostrocaudal levels, before stimulation. A multipathway system may explain the variability in autonomic responses to visceral and somatic stimuli exhibited in spinally injured patients.     

Effects of intradialytic exercise on health-related quality of life in patients undergoing maintenance haemodialysis: a systematic review and meta-analysis

Quality of Life Research - To summarize the current evidence regarding the effectiveness of intradialytic exercise (IDE) on the health-related quality of life (HRQOL) of patients undergoing...     

Particle Filtration Efficiency Testing of Sterilization Wrap Masks

ObjectivesNon-traditional materials are used for mask construction to address personal protective equipment shortages during the coronavirus disease 2019 (COVID-19) pandemic. Reusable masks made from surgical sterilization wrap represent such an innovative approach with social media frequently referring to them as “N95 alternatives.” This material was tested for particle filtration efficiency and breathability to clarify what role they might have in infection prevention and control.MethodsA heavyweight, double layer sterilization wrap was tested when new and after 2, 4, 6, and 10 autoclave sterilizing cycles and compared with an approved N95 respirator and a surgical mask via testing procedures using a sodium chloride aerosol for N95 efficiency testing similar to 42 CFR 84.181. Pressure testing to indicate breathability was also conducted.ResultsThe particle filtration efficiency for the sterilization wrap ranged between 58% to 66%, with similar performance when new and after sterilizing cycles. The N95 respirator and surgical mask performed at 95% and 68% respectively. Pressure drops for the sterilization wrap, N95 and surgical mask were 10.4 mmH₂O, 5.9 mmH₂O, and 5.1 mmH₂O, respectively, well below the National Institute for Occupational Safety and Health limits of 35 mmH₂O during initial inhalation and 25 mmH₂O during initial exhalation.ConclusionsThe sterilization wrap’s particle filtration efficiency is much lower than a N95 respirator, but falls within the range of a surgical mask, with acceptable breathability. Performance testing of non-traditional mask materials is crucial to determine potential protection efficacy and for correcting misinterpretation propagated through popular media.     

Familial Transmission of Alcohol Use Norms and Expectancies and Reported Alcohol Use

Members of 183 families (biological parents and one adult offspring) completed questionnaires on their quantity and frequency of alcohol use, what they would consider a "normal" quantity-frequency of alcohol use, "problem" quantity-frequency of use, flushing after alcohol use, and other expected physiological and subjective responses to alcohol. Within individuals, own quantity-frequency of alcohol use was moderately negatively correlated with flushing after one drink or less ("fast flushing"), but more highly positively correlated with judged normal alcohol use and with expected subjective effects. Spouse resemblances were low for quantity-frequency of alcohol use and flushing, but high for alcohol use norms and expected physiological and subjective responses. Parent-offspring resemblances were low to moderate for own alcohol use and flushing, but moderate to high for expected physiological and subjective effects. These results were discussed in terms of the effects of genetically transmitted flushing after alcohol use and culturally transmitted alcohol norms and expectations on alcohol use.     

GABA(A) receptors mediate inhibition of T cell responses

We describe the presence of functional GABA(A) receptors on T cells. GABA inhibited anti-CD3 and antigen-specific T cell proliferation in vitro in a dose-dependent manner that was 1) mimicked by the GABA(A) receptor agonist muscimol (but not the GABA(B) receptor agonist baclofen), 2) blocked by GABA(A) receptor antagonists and a GABA(A) receptor Cl- channel blocker (picrotoxin) and 3) enhanced by pentobarbital. These data suggest that GABA(A) receptors mediate this immune inhibition and that these receptors can be modulated in a similar fashion to their neuronal counterparts. Finally, GABA inhibited DTH responses in vivo. Thus, pharmacological modulation of GABA(A) receptors may provide new approaches to modulate T cell responses in inflammation and autoimmune disease.