Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Brucellosis is a world prevalent endemic illness that is transmitted from domestic animals to humans. Brucella spp. exploits urease for survival in the harsh conditions of stomach during the gastrointestinal infection. In this study, we examined the immune response and the protection elicited by using recombinant Brucella urease (rUrease) vaccination in BALB/c mice. The urease gene was cloned in pET28a and the resulting recombinant protein was employed as subunit vaccine. Recombinant protein was administered subcutaneously and intraperitoneally. Dosage reduction was observed with subcutaneous (SC) vaccination when compared with intraperitoneal (IP) vaccination. rUrease induced mixed Th1–Th2 immune responses with high titers of specific IgG1 and IgG2a. In lymphocyte proliferation assay, splenocytes from IP and SC‐vaccinated mice displayed a strong recall proliferative response with high amounts of IL‐4, IL‐12 and IFN‐γ production. Vaccinated mice were challenged with virulent Brucella melitensis, B. abortus and B. suis. The SC vaccination route exhibited a higher degree of protection than IP vaccination (p value ≤ 0.05). Altogether, our results indicated that rUrease could be a useful antigen candidate for the development of subunit vaccines against brucellosis. 相似文献
Doxorubicin (DOX) is the most commonly used anticancer drug; however, it has limited use because prolonged administration may result in severe cardiotoxicity. Simvastatin (SIM), generally prescribed for hypercholesterolaemia, has also shown salubrious results in the monotherapy or combinational drug therapy of different cancers in various models. Nanoparticle drug delivery systems are a novel way of improving therapeutics and also improving the absorption and specificity of drugs towards tumour cells. In this study, we exploited this technology to increase drug specificity and minimize imminent adverse effects. In this study, the antitumour activity of the combination formulas of DOX and SIM, either loaded in water (DOX‐SIM‐Solution) or nanoemulsions (NEs) (DOX‐SIM‐NE), was evaluated in a Swiss albino mouse model of Ehrlich ascites carcinoma. The anticancer effect was assessed by quantifying the change in body weight, mean survival time, and percent increase in lifespan (%ILS), determining haematological and serum biochemical parameters (liver function test, kidney function test and lipid profile parameters) as well as studying the histopathological alterations in liver tissues. We observed a clear increase in %ILS of the DOX‐SIM‐Solution group (265.30) that was double the %ILS of the DOX‐SIM‐NE group (134.70). However, DOX‐SIM‐NE had a non‐toxic effect on the haematological parameters, whereas DOX‐SIM‐Solution increased the levels of haemoglobin and lymphocytes. Furthermore, the encapsulation of SIM and DOX into NEs improved the levels of all serum biochemical parameters compared to the DOX‐SIM‐Solution. A reduction in the side effects of DOX‐SIM‐NE on the liver was also established using light microscopy, which revealed that the morphologies of the hepatocytes of the mice were less affected by administration of the DOX‐SIM‐NE treatment than with the DOX‐SIM‐Solution treatment. The study showed that incorporating SIM into the DOX‐loaded‐NE formulation remarkably improved its efficiency and simultaneously reduced its adverse effects. 相似文献
Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.
Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.
Results: Our findings show Hookah smoking [OR = 6.1(CI95%:1.2–13.1)] and opium consumption [OR = 2.1(CI95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.
Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district. 相似文献
Iatrogenic injury of the Profunda Femoris Artery (PFA) at time of hip fixation surgery can increase morbidity and mortality and prolong the hospital stay. This is an injury that tends to pass unnoticed as a cause of postoperative deterioration despite being frequently reported in the literature. Our study aims to describe the anatomy of the PFA in relation to the medial femoral cortex with specific emphasis on its orientation relative to the position of a sliding hip screw side plate construct. By doing so we are able to present clear guidance to orthopaedic surgeons on how to avoid iatrogenic PFA injury at the time of hip fracture fixation.
Methods
Using Computed Tomography Angiographic (CTA) studies, the course of the PFA in relation to the medial femoral cortex was traced in 44 patients (28 males and 16 females) with mean age of 65.6 years. Coronal and axial CT sections were cross-linked to specify the position of the PFA at 1?cm intervals.
Results
The course of the artery could be divided into three parts relative to a fixed reference point. Proximal and distal parts of the artery were in a safer position in comparison to the middle part of the artery that was found very close to the femoral cortex and along the coronal axis of the femur (mean angle 2.9° from the femoral coronal axis and 13.8?mm from the medial femoral cortex). Using the commercially available side plate constructs, this part of the artery corresponded to the distal part of the plate (third and fourth holes).
Conclusion
Special attention needs to be practiced by the operating surgeon while drilling into the third and fourth holes of the side plate. 相似文献
The floating metacarpal bone is a result of simultaneous fracture-dislocation of both carpometacarpal and metacarpophalangeal joints. This rare entity may be associated with other hand injuries. Here we present a floating index metacarpal with concomitant 3rd–5th carpometacarpal fracture-dislocations. Excellent functional short-term result was achieved after open metacarpopha langeal reduction and closed carpometacarpal reduction and percutaneous pinning. 相似文献
In December 2019, a new type of coronavirus was detected for the first time in Wuhan, Hubei Province, China. According to the reported data, the emerging coronavirus has spread worldwide, infecting more than fifty-seven million individuals, leading to more than one million deaths. The current study aimed to review and discuss the hematological findings of COVID-19. Laboratory changes and hematologic abnormalities have been reported repeatedly in COVID-19 patients. WBC count and peripheral blood lymphocytes are normal or slightly reduced while these indicators may change with the progression of the disease. In addition, several studies demonstrated that decreased hemoglobin levels in COVID-19 patients were associated with the severity of the disease. Moreover, thrombocytopenia, which is reported in 5%-40% of patients, is known to be associated with poor prognosis of the disease. COVID-19 can present with various hematologic manifestations. In this regard, accurate evaluation of laboratory indicators at the beginning and during COVID-19 can help physicians to adjust appropriate treatment and provide special and prompt care for those in need. 相似文献
The World Health Organization has reported an annual global suicide rate of 14.5 per 100,000 people. On the other hand, it is estimated that approximately one‐third of the global population are infected with Toxoplasma gondii (T. gondii) parasite. It is widely assumed that microbial pathogens, such as T. gondii, are probably associated with affective and behavioural modulation. The present article aimed to assess the proposed role of toxoplasmosis in raising the risk of suicidal ideation (SI) and suicide attempts (SA) using the available epidemiological data. Seven major electronic databases and the Internet search engine Google were searched for all the studies published between the 1st of January 1950 and 31st of October 2019. The heterogeneity and the risk of bias within and across studies were assessed. Following data extraction, pooled odds ratios (ORs) with 95% confidence interval (CI) across studies were calculated using the random‐effects models. A total number of 9,696 articles were screened and 27 studies were regarded as eligible in our systematic review (SI with five papers and 22 papers on SA). A significant association was detected between antibodies against T. gondii with TA (ORs = 1.57; 95% confidence interval [CI] 1.23–2.00, p = .000). Exploration of the association between T. gondii and SA yielded a positive effect of seropositivity for IgG antibodies but not IgM. Despite the limited number of studies, a statistical association was detected between suicidal behaviours and infection with latent T. gondii. 相似文献