A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Tobacco consumption,opium use,alcohol drinking and the risk of esophageal cancer in North Khorasan,Iran

Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.

Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.

Results: Our findings show Hookah smoking [OR = 6.1(CI_95%:1.2–13.1)] and opium consumption [OR = 2.1(CI_95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.

Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district.     

Identification of the medial femoral safe zone for drilling during dynamic hip screw side plate fixation: A CT angiogram tracing of the profunda femoris artery

Objectives

Iatrogenic injury of the Profunda Femoris Artery (PFA) at time of hip fixation surgery can increase morbidity and mortality and prolong the hospital stay. This is an injury that tends to pass unnoticed as a cause of postoperative deterioration despite being frequently reported in the literature. Our study aims to describe the anatomy of the PFA in relation to the medial femoral cortex with specific emphasis on its orientation relative to the position of a sliding hip screw side plate construct. By doing so we are able to present clear guidance to orthopaedic surgeons on how to avoid iatrogenic PFA injury at the time of hip fracture fixation.

Assessment of heavy metals by ICP-OES and their impact on insulin stimulating hormone and carbohydrate metabolizing enzymes

Arsenic (As) and cadmium (Cd) have recently emerged as major health concerns owing to their strong association with diabetes mellitus (DM). We aimed to investigate the heavy metals exposure towards incidence of DM at various enzymatic and hormonal levels. Additionally, association of As and Cd with Zinc (Zn, essential metal) was also evaluated. Spot urine samples were collected to assess As, Cd and Zn through ICP-OES. Serum was analyzed by assay method for fasting blood glucose, liver and renal function biomarkers. ELISA was performed to investigate the impact of heavy metals on HbA1c, α-amylase, DPP-IV, IGF-1, leptin, GSH, MDA, SOD, HDL, FFA, TG and interleukin (IL)-6. Association of heavy metals with DM was measured by odds ratio (OR) and level of significance was assessed by Chi-squared test. Unpaired student's t-test was used to compare DM-associated risk factors in heavy metals-exposed and unexposed participants. As and Cd were detectable in 75.4% and 83% participants with mean concentration of 75.5 ppb and 54.5 ppb, respectively. For As exposure, OR in the third quartile was maximum ie 1.34 (95% CI, 0.80 to 2.23), however the result was not statistically significant (P > .05). For Cd exposure, OR in the fourth quartile was considerably high, 1.62 (95% CI, 1.00 to 2.61), with a significant probability value (P < .05). Urinary Cd was negatively associated with Zn. As and Cd exposure increases the incidence of DM in the general population. Impaired hormonal and enzymatic levels in diabetic and non-diabetic exposed participants reflect the multiple organ damage by heavy metal exposure.     

Primary adenocarcinoma of the appendix

Thirteen cases of primary appendicular adenocarcinoma are reported. This rare tumour usually presents as acute appendicitis. The correct diagnosis is rarely entertained before or during surgery. The main treatment choice lies between appendicectomy alone and appendicectomy followed by right hemicolectomy. There are anatomical reasons for advising the latter and survival figures from the literature tend to support this preference. The cases reported here indicate that in the period 1972-1984, in the North West Region, there was a slight preference for appendicectomy alone. The additional procedure of right hemicolectomy did not confer any clear-cut survival advantage.     

Outcome and clinical course in inpatient bulimic women: a 2- to 9-year follow-up study

BACKGROUND: One previous follow-up study suggested that inpatient bulimic women do quite poorly; after an interval of 2 to 5 years, only 13% were recovered. To examine the course and outcome of a sample of patients with bulimia nervosa that was severe enough to require inpatient hospitalization, the authors conducted the following study. METHOD: Women (N = 52) with DSM-III-R bulimia nervosa were sought 2 to 9 years after hospitalization. Prior to contact, a retrospective chart review was conducted to determine global functioning and admission diagnoses. At follow-up, patients participated in a 4 to 6 hour interview that assessed current and lifetime Axis I disorders (SCID-I), current Axis II disorders (PDE), eating behaviors (EAT, BSQ, EDI, PSR), global functioning (GAF), social adjustment (SAS-SR), and treatment and medical problems experienced since discharge. To assess the significance of differences between the recovered and the currently bulimic women, Yates-corrected chi-square tests and two-tailed t tests were used. RESULTS: Of the 52 women, 46 were interviewed, 1 had died, and 5 could not be located. Of the 46 interviewed women, 39% had fully recovered, 20% had partially recovered, and 41% were currently bulimic. The likelihood of recovery increased with length of time since discharge. While medical problems related to the bulimia were few, treatment with phenelzine was associated with three reports of serious hypertensive episodes, one of which led to death. Global functioning before hospitalization, lifetime DSM-III-R Axis I diagnoses, and current Axis II diagnoses were not associated with outcome. CONCLUSIONS: These findings suggest that even severely ill bulimic patients have a significant chance of achieving full recovery.     

Comparative assays of the rpoB gene for identification of Mycobacterium tuberculosis isolated from patients in Sudan.

OBJECTIVES: To characterise mycobacterial clinical isolates based on amplification of the rpoB gene. SETTING: One hundred and thirty-five mycobacterial isolates cultured from suspected pulmonary tuberculosis (TB) patients were identified phenotypically. Molecular characterisation of the isolates was performed based on amplification of the rpoB gene, using duplex polymerase chain reaction (DPCR), PCR-restriction fragment length polymorphism (RFLP) and nested PCR-based sequence analysis techniques. RESULTS: The DPCR assay identified 129 of 135 (95.5%) clinical isolates as Mycobacterium tuberculosis complex species. Restriction enzyme analysis of the rpoB PCR product using Hind II identified 134 of the 135 (99.3%) isolates as M. tuberculosis complex, while nested PCR sequence analysis of the rpoB gene identified 133/133 examined isolates (100%) as M. tuberculosis species. No mycobacteria other than M. tuberculosis (MOTT) were detected among the studied isolates. CONCLUSION: DPCR, PCR/RFLP Hind II and nested PCR sequence analysis of the rpoB gene techniques showed comparable efficiency in the characterisation of Mycobacterium isolates. Nested PCR sequence analysis of the rpoB gene was superior to PCR/RFLP for characterisation of suspected M. tuberculosis isolates, while the DPCR technique showed less sensitivity. As PCR-RFLP requires less sophisticated laboratory facilities than nested PCR sequence analysis, it would be more appropriate to be adopted for accurate characterisation of mycobacteria in countries with a weak infrastructure.     

Characteristics of patients with congenital clasped thumb: a prospective study of 40 patients with the results of treatment

Purpose  Congenital clasped thumb is a deformity that is associated with heterogeneous congenital anomalies and it has been addressed in many congenital syndromes. The aim of this study was to diagnose and evaluate cases of clasped thumb as regards the associated congenital anomalies and syndromes, and evaluation of the results of treatment of such cases. Methods  A prospective study on 40 patients with 73 clasped thumbs was done. All the patients’ data regarding their personal, family, pregnancy and developmental histories were recorded. All the patients were exposed to thorough clinical and radiological examination and genetic assessment. The cases were classified using the Tsuyuguchi et al. (J Hand Surg [Am] 10:613–618, 1985) classification into three types. Conservative treatment was adopted in ten hands, and surgical treatment was performed for 28 hands in 17 patients, with an average follow-up of 26 months. Results  Positive consanguinity was recorded in 57.5% of cases. Associated anomalies were recorded in 77.5% of cases. Type I was the most common one, followed by type III and then type II. Conservative treatment is effective in type I cases when presented early, and all patients were satisfied with the results of surgical treatment. Conclusions  We reported associated anomalies which are to our knowledge have not mentioned before in the literature which include; congenital blindness, radial deviation of the index finger and ventricular septal defect. We found that 68% of the patients had associated syndromes, and this has not been mentioned before. In this study, we found that there were no difference between type II and type III clasped thumb as regards the pathological findings, severity, the operative procedures, the treatment protocol and the operative results. Properly planned treatment gives satisfactory results.