Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Management of type 1 diabetes in adolescence is a complex task requiring self-control within individual and interpersonal domains. This is similarly requisite for academic achievement. Grade point average (GPA) was examined as a barometer of diabetes management reflective of self-control in a challenging daily context. Adolescents with type 1 diabetes (n = 172) completed questionnaires on self-control, self-efficacy, parent/peer relationships, and adherence, while mothers reported GPA. Self-control, self-efficacy, and parent/peer relationships predicted GPA, adherence and HbA1c. GPA predicted HbA1c above and beyond adherence and self-control predictors. GPA may be a valuable indicator of individual and interpersonal self-control processes required for diabetes management. 相似文献
Clinical Rheumatology - This study aims to assess rheumatologists’ perceptions, utilization patterns, and attitudes towards the modified New York (mNY) criteria for ankylosing spondylitis... 相似文献
Copy number variation (CNV) contributes to disease and has restructured the genomes of great apes. The diversity and rate of this process, however, have not been extensively explored among great ape lineages. We analyzed 97 deeply sequenced great ape and human genomes and estimate 16% (469 Mb) of the hominid genome has been affected by recent CNV. We identify a comprehensive set of fixed gene deletions (n = 340) and duplications (n = 405) as well as >13.5 Mb of sequence that has been specifically lost on the human lineage. We compared the diversity and rates of copy number and single nucleotide variation across the hominid phylogeny. We find that CNV diversity partially correlates with single nucleotide diversity (r2 = 0.5) and recapitulates the phylogeny of apes with few exceptions. Duplications significantly outpace deletions (2.8-fold). The load of segregating duplications remains significantly higher in bonobos, Western chimpanzees, and Sumatran orangutans—populations that have experienced recent genetic bottlenecks (P = 0.0014, 0.02, and 0.0088, respectively). The rate of fixed deletion has been more clocklike with the exception of the chimpanzee lineage, where we observe a twofold increase in the chimpanzee–bonobo ancestor (P = 4.79 × 10−9) and increased deletion load among Western chimpanzees (P = 0.002). The latter includes the first genomic disorder in a chimpanzee with features resembling Smith-Magenis syndrome mediated by a chimpanzee-specific increase in segmental duplication complexity. We hypothesize that demographic effects, such as bottlenecks, have contributed to larger and more gene-rich segments being deleted in the chimpanzee lineage and that this effect, more generally, may account for episodic bursts in CNV during hominid evolution.Sequence and assembly of great ape reference genomes have consistently revealed that copy number variation (CNV) affects more base pairs than single nucleotide variation (SNV) (Cheng et al. 2005; The Chimpanzee Sequencing and Analysis Consortium 2005; Locke et al. 2011). Segmental duplications, in particular, have disproportionately affected the African great ape (human, chimpanzee, and gorilla) lineages, where they appear to have accumulated at an accelerated rate (Cheng et al. 2005; Marques-Bonet et al. 2009). This has led to speculation that differences in fixation and copy number polymorphism may have contributed to the phenotypic “plasticity” and species-specific differences between humans and great apes (Olson 1999; Varki et al. 2008). While there is some evidence that fixed deletions and duplications contribute to morphological differences between humans and great apes (McLean et al. 2011; Charrier et al. 2012; Dennis et al. 2012), a comprehensive assessment of these differences at the level of the genome has not yet been performed. Previous studies of CNV have been predominated by array comparative genomic hybridization (CGH) experiments (Fortna et al. 2004; Perry et al. 2006; Dumas et al. 2007; Gazave et al. 2011; Locke et al. 2011), which provide limited size resolution, are imprecise in absolute copy number differences, and are biased by probes derived from the human reference genome. Comparisons of reference genomes have been complicated by assessments of a single individual and distinguishing CNVs from assembly errors (The Chimpanzee Sequencing and Analysis Consortium 2005; Locke et al. 2011; Ventura et al. 2011; Prüfer et al. 2012). Here, we compare the evolution and diversity of deletions, duplications, and SNVs in 97 great ape individuals sequenced to high coverage (median ∼25×) (Prado-Martinez et al. 2013). The set includes multiple individuals from the four great ape genera, including Bornean and Sumatran orangutans, each of the four recognized chimpanzee subspecies, bonobos, and both Eastern and Western gorillas, in addition to 10 diverse humans and a high-coverage archaic Denisovan individual. This data set provides unprecedented genome-wide resolution to interrogate multiple forms of genetic variation and a unique opportunity to directly compare mutational processes and patterns of diversity in great apes. 相似文献
Systemic inflammation and increased matrix metalloproteinase (MMP) cause elastin degradation leading to abdominal aortic aneurysm (AAA) expansion. Several prospective studies report that statin therapy can reduce AAA expansion through anti-inflammation. We hypothesize that monocyte activity plays a pivotal role in this AAA development and this study examines patient peripheral blood monocyte cell adhesion, transendothelial migration, and MMP concentrations between AAA and non-AAA patients.
Materials and methods
Peripheral blood was collected and monocytes isolated from control (n = 15) and AAA (n = 13) patients. Monocyte adhesion, transmigration, and permeability assays were assessed. Luminex assays determined MMP-9 and tissue inhibitor of metalloproteinase-4 (TIMP-4) concentrations from cell culture supernatant and patient serum.
Results
AAA patient monocytes showed increased adhesion to the endothelium relative fluorescence units (RFU, 0.33 ± 0.17) versus controls (RFU, 0.13 ± 0.04; P = 0.005). Monocyte transmigration was also increased in AAA patients (RFU, 0.33 ± 0.11) compared with controls (RFU, 0.25 ± 0.04, P = 0.01). Greater numbers of adhesive (R2 = 0.66) and transmigratory (R2 = 0.86) monocytes were directly proportional to the AAA diameter. Significantly higher serum levels of MMP-9 (2149.14 ± 947 pg/mL) were found in AAA patients compared with controls (1189.2 ± 293; P = 0.01). TIMP-4 concentrations were significantly lower in AAA patients (826.7 ± 100 pg/mL) compared with controls (1233 ± 222 pg/mL; P = 0.02). Cell culture supernatant concentrations of MMP and TIMP from cocultures were higher than monocyte-only cultures.
Conclusions
Monocytes from AAA patients have greater adhesion and transmigration through the endothelium in vitro, leading to elevated MMP-9 levels and the appropriate decrease in TIMP-4 levels. The ability to modulate monocyte activity may lead to novel medical therapies to decrease AAA expansion. 相似文献
This case study examines the comparative effect of no-use school tobacco policies and restricted-use tobacco policies on teacher and student smoking behaviors and attitudes. Data from teachers (n = 1,041) and ninth-grade students (n = 4,763) at 20 schools in five districts in southern Louisiana were available. No significant difference was observed between teacher smoking (11% vs. 13%, p = .42) or student smoking (24.6% vs. 25.2%, p = .75) at no-use versus restricted-use policy schools. The proportion of teachers smoking on campus at no-use or restricted-use schools was not significantly different. Teachers at restricted-use schools were however less concerned about students seeing teachers smoke and less supportive of a no-use policy than teachers at no-use schools. Tobacco use policies are often not promoted, and enforcement of policies impacting teachers is complex. Changing social norms for smoking at high schools through policy promotion and enforcement is understudied. 相似文献
Cancer is the second leading cause of death in the US and in Mississippi. Breast cancer (BC) is the most common cancer among women, and the underlying pathophysiology remains unknown, especially among African American (AA) women. The study purpose was to examine the joint effect of menopause status (MS) and hormone replacement therapy (HRT) on the association with cancers, particularly BC using data from the Jackson Heart Study. The analytic sample consisted of 3202 women between 35 and 84 years of which 73.7% and 22.6% were postmenopausal and on HRT, respectively. There were a total of 190 prevalent cancer cases (5.9%) in the sample with 22.6% breast cancer cases. Menopause (p<0.0001), but not HRT (p=0.6402), was independently associated with cancer. Similar results were obtained for BC. BC, cancer, hypertension, type 2 diabetes, prevalent cardiovascular disease, physical activity and certain dietary practices were all significantly associated with the joint effect of menopause and HRT in the unadjusted analyses. The family history of cancer was the only covariate that was significantly associated with cancer in the age-adjusted models. In examining the association of cancer and the joint effect of menopause and HRT, AA women who were menopausal and were not on HRT had a 1.97 (95% CI: 1.15, 3.38) times odds of having cancer compared to pre-menopausal women after adjusting for age; which was attenuated after further adjusting for family history of cancer. Given that the cancer and BC cases were small and key significant associations were attenuated after adjusting for the above mentioned covariates, these findings warrant further investigation in studies with larger sample sizes of cancer (and BC) cases. 相似文献
Weight regain (WR) and insufficient weight loss (IWL) after sleeve gastrectomy (SG) are challenging issues. This study aimed to evaluate the predictors of WR and IWL after SG.
Methods
In this retrospective analytical study, 568 patients who underwent SG at Hazrat-e Rasool General Hospital, Tehran, Iran, between January 2015 and April 2022 were evaluated. A total of 333 patients were included. WR and IWL were evaluated by multiple criteria such as a BMI of > 35 kg/m2, an increase in BMI of > 5 kg/m2 above nadir, an increase in weight of > 10 kg above nadir, percentage of excess weight loss (%EWL) < 50% at 18 months, an increase in weight of > 25% of EWL from nadir at 36 months, and percentage of total weight loss (%TWL) < 20% at 36 months. All participants were followed up for 36 months.
Result
The univariate analysis showed that preoperative BMI, obstructive sleep apnea, metformin consumption, and grades 2 and 3 fatty liver disease were associated with WR and IWL (P < 0.05). WR or IWL incidence varied (0–19.3%) based on different definitions. The multivariate analysis showed that a preoperative BMI of > 45 kg/m2 [odds ratioAdjusted (ORAdj) 1.77, 95% CI: 1.12–4.11, P = 0.038] and metformin consumption [ORAdj: 0.48, 95% CI: 0.19–0.78, P = 0.001] were associated with WR and IWL after SG, regardless of the definition of WR or IWL.
Conclusion
This study showed that preoperative BMI of > 45 kg/m2, obstructive sleep apnea, metformin consumption, and grades 2 and 3 of fatty liver disease were associated with WR or IWL.
Prevention Science - Evidence of the effectiveness of community-based lifestyle behavior change interventions among African-American adults is mixed. We implemented a behavioral lifestyle change... 相似文献
Genetic interactions provide a powerful perspective into gene function, but our knowledge of the specific mechanisms that give rise to these interactions is still relatively limited. The availability of a global genetic interaction map in Saccharomyces cerevisiae, covering ~30% of all possible double mutant combinations, provides an unprecedented opportunity for an unbiased assessment of the native structure within genetic interaction networks and how it relates to gene function and modular organization. Toward this end, we developed a data mining approach to exhaustively discover all block structures within this network, which allowed for its complete modular decomposition. The resulting modular structures revealed the importance of the context of individual genetic interactions in their interpretation and revealed distinct trends among genetic interaction hubs as well as insights into the evolution of duplicate genes. Block membership also revealed a surprising degree of multifunctionality across the yeast genome and enabled a novel association of VIP1 and IPK1 with DNA replication and repair, which is supported by experimental evidence. Our modular decomposition also provided a basis for testing the between-pathway model of negative genetic interactions and within-pathway model of positive genetic interactions. While we find that most modular structures involving negative genetic interactions fit the between-pathway model, we found that current models for positive genetic interactions fail to explain 80% of the modular structures detected. We also find differences between the modular structures of essential and nonessential genes. 相似文献