Brachial artery hemodynamic response to acute converting enzyme inhibition by enalaprilat in essential hypertension

To assess the vascular involvement of renin-angiotensin system inhibition in human hypertension, acute effects of intravenous enalaprilat on brachial artery diameter, blood flow, and blood velocity were investigated in hypertensive patients by pulsed Doppler technique and compared with effects of saline vehicle. Compared with saline vehicle, enalaprilat reduced blood pressure (P less than 0.001) and increased brachial arterial diameter (P less than 0.01) and brachial blood flow (P less than 0.01). Enalaprilat effect on arterial pulse pressure was dependent on preinjection pulse pressure (r = -0.76; P less than 0.001), but its effect on mean blood pressure was not dependent on preinjection mean blood pressure. On the other hand, enalaprilat effect on arterial blood flow was negatively correlated with preinjection blood pressure (r = -0.64; P less than 0.02). The findings point to different responses of large and small arteries to intravenous enalaprilat.     

Evidence that [3H]-alpha,beta-methylene ATP may label an endothelial-derived cell line 5'-nucleotidase with high affinity.

1. In membranes prepared from a permanent cell line of endothelial origin (WEC cells), [3H]-alpha, beta-methylene ATP ([3H]-alpha, beta-meATP) labelled high (pKd = 9.5; Bmax = 3.75 pmol mg-1 protein) and low (pKd = 7.2; Bmax = 23.3 pmol mg-1 protein) affinity binding sites. The high affinity [3H]-alpha, beta-meATP binding sites in the WEC cell membranes could be selectively labelled with a low concentration of the radioligand (1 nM). In competition studies performed at a radioligand concentration of 1 nM, 88.6% of the sites possessed high affinity (pIC50 = 8.26) for alpha, beta-meATP. 2. The high affinity [3H]-alpha, beta-meATP binding sites appeared heterogeneous since in competition studies a number of nucleotide analogues (alpha, beta-meADP, ATP, ADP, AMP, GTP, GppNHp, GMP) and adenosine identified two populations of the sites labelled by 1 nM [3H]-alpha, beta-meATP. The proportion of sites with high affinity for these compounds was found to vary between 42 and 69%. 3. Approximately 60-69% of the binding sites labelled with 1 nM [3H]-alpha, beta-meATP possessed high affinity for alpha, beta-meADP (pIC50 = 8.87), AMP (pIC50 = 7.12), GMP (pIC50 = 7.34), UTP (pIC50 = 6.12), GTP (pIC50 = 7.59), GppNHp (pIC50 = 7.35) and adenosine (pIC50 = 5.45).(ABSTRACT TRUNCATED AT 250 WORDS)     

Analgesic profile of the sodium salt of pemedolac

Pemedolac Na, 1-ethyl-1,3,4,9-tetrahydro-4-(phenylmethyl)-pyrano [3,4-b] indole-1-acetic acid sodium salt, exhibited equipotent analgesic effects after oral, iv, and im administration, suggesting that it is well absorbed. In mouse writhing models, the ED₅₀ values ranged from 0.3 mg (0.81 μmol)/kg (vs. acetylcholine) to 4.3 mg (11.6 μmol)/kg (vs. paraphenylbenzoquinone [PBQ]). In the rat Randall-Selitto model, the ED₅₀ o the compound was approximately 0.001 mg (2.7 nmol)/kg, with a flat dose response curve. The peak effects lasted for 7–9 h, 10–18 h, and 5 h following oral, im, and iv injections, respectively. Intracerebroventricular (i.c.v.) injections of pemedolac Na inhibited the PBQ-induced writing in mice with an ED₅₀ of 43.5 μg (0.12 μmol)/mouse, and this effect was not antagonized by naloxone. It was inactive in the hot plate and tail flick tests, demonstrating that pemedolac Na does not act via an opiate mechanism. These results indicate that pemedolac Na is a viable parenteral and oral analgesic, typified by high analgesic potency, a rapid onset and long duration of action, and an extremely wide safety index. © Wiley-Liss, Inc.     

Physiologic characterization of endothelin A and B receptor activity in the ovine fetal pulmonary circulation.

To determine the potential contribution of endothelin (ET) to modulation of high pulmonary vascular resistance in the normal fetus, we studied the effects of BQ 123, a selective ET-A receptor antagonist, and sarafoxotoxin S6c (SFX), a selective ET-B receptor agonist, in 31 chronically prepared late gestation fetal lambs. Brief intrapulmonary infusions of BQ 123 (0.1-1.0 mcg/min for 10 min) caused sustained increases in left pulmonary artery flow (Qp) without changing main pulmonary artery (MPA) and aortic (Ao) pressures. In contrast, BQ 123 did not change vascular resistance in a regional systemic circulation (the fetal hindlimb). To determine whether big-endothelin-1 (big-ET-1)-induced pulmonary vasoconstriction is mediated by ET-A receptor stimulation, we studied the effects of big-ET-1 with or without pretreatment with BQ 123. BQ 123 (0.5 mcg/min for 10 min) blocked the rise in total pulmonary resistance caused by big-ET-1. CGS 27830 (100 mcg/min for 10 min), an ET-A and -B receptor antagonist, did not change basal tone but blocked big-ET-1-induced pulmonary vasoconstriction. Brief and prolonged intrapulmonary infusion of SFX (0.1 mcg/min for 10 min) increased Qp twofold without changing MPA or Ao pressures. Nitro-L-arginine (L-NA), a selective endothelium-derived nitric oxide (EDNO) antagonist, blocked vasodilation caused by BQ 123 and SFX. We conclude that: (a) BQ 123 causes sustained fetal pulmonary vasodilation, but did not change vascular resistance in the fetal hindlimb; (b) Big-ET-1-induced pulmonary vasoconstriction may be mediated through ET-A receptor stimulation; and (c) ET-B receptor stimulation causes pulmonary vasodilation through EDNO release. These findings support the hypothesis that endothelin may play a role in modulation of high basal pulmonary vascular resistance in the normal fetus.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

(-)Deprenyl increases activities of superoxide dismutase and catalase in striatum but not in hippocampus: the sex and age-related differences in the optimal dose in the rat.

The dose of (-)deprenyl (2.0 mg/kg/day, sc, for 3 weeks) which significantly increased activities of superoxide dismutase (SOD) and catalase in the striatum of young male rats significantly reduced these activities in young female rats but did not change the SOD activity in old female rats. In order to clarify these effects, different doses of the drug were continuously infused sc for 3 weeks in three groups of rats (young males and young and old females). When a 10-fold smaller dose (0.2 mg/kg/day) was applied in young female rats, activities of both SOD and catalase were significantly increased, while a higher dose of 0.5 mg/kg/day was ineffective and a lower dose of 0.1 mg/kg/day was substantially less effective. In old female rats, doses of both 0.5 and 1.0 mg/kg/day were equally effective in elevating activities of SOD and catalase, while a lower dose of 0.1 mg/kg/day was less effective. The activity of glutathione peroxidase (GSH Px) remained unchanged in all groups, except for a significant decrease in the activity of non-selenium-dependent GSH Px in both young and old female rats given the highest drug dose (2.0 mg/kg/day). Furthermore, activities of all three enzymes remained unchanged in the hippocampus in most groups. The results indicate that (-)deprenyl significantly increases activities of both SOD and catalase in the striatum, but not in hippocampus of rats, and that the optimal dose is very different depending on the sex and age of the animal.     

Normal and borderline ambulatory arterial pressures. A new method for establishing reference values

Ambulatory arterial pressures, both systolic (SAP) and diastolic (DAP), together with heart rate were measured every 15 minutes during 24 hours, using a Spacelabs 5200 apparatus, in 168 male subjects of mean age 21 +/- 1 years. According to the WHO criteria, 72 subjects had normal arterial pressure (clinical DAP less than or equal to 90 mmHg, clinical SAP less than or equal to 140 mmHg), and 86 subjects had untreated borderline arterial hypertension (abnormal clinical pressures, with clinical DAP less than or equal to 95 mmHg and clinical SAP less than or equal to 160 mmHg). On the basis of the WHO criteria, a sizeable part of pressure profiles in the normal and hypertensive groups overlapped. The Mc Queen method, derived from cluster analysis, considerably reduces this overlap. The method defines and objective criterion which enables the subjects to be reclassified in cases where clinical and ambulatory pressures "contradict each other". Such reclassification applied in about 20% of our subjects. This leads to a new definition of reference groups based on both clinical pressure and ambulatory pressure profile. The WHO criteria remain the basis for this classification. The Mc Queen method may be used to define normal and borderline arterial pressure profiles in male and female subjects of different age-groups.     

Mechanical Analysis of Atherosclerotic Plaques Based on Optical Coherence Tomography

Finite element analysis is a powerful tool for investigating the biomechanics of atherosclerosis and has thereby provided an improved understanding of acute myocardial infarction. Structural analysis of arterial walls is traditionally performed using geometry contours derived from histology. In this paper we demonstrate the first use of a new imaging technique, optical coherence tomography (OCT), as a basis for finite element analysis. There are two primary benefits of OCT relative to histology: 1) imaging is performed without excessive tissue handling, providing a more realistic geometry than histology and avoiding structural artifacts common to histologic processing, and 2) OCT imaging can be performed in vivo, making it possible to study disease progression and the effect of therapeutic treatments in animal models and living patients. Patterns of mechanical stress and strain distributions computed from finite element analysis based on OCT were compared with those from modeling based on "gold standard" histology. Our results indicate that vascular structure and composition determined by OCT provides an adequate basis for investigating the biomechanical factors relevant to atherosclerosis and acute myocardial infarction.