Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
INTRODUCTIONThis study aimed to investigate the therapeutic response to injected human umbilical cord blood mesenchymal stem cells (UCBMSCs) among albino rats with streptozotocin (STZ)-induced diabetes mellitus.METHODSControl group (GI; n = 25) rats were fed with standard rat diet. Rats with STZ-induced diabetes mellitus without (GII; n = 25) and with (GIII; n = 25) differentiated human UCBMSCs implantation were the test groups. Rats were sacrificed in Week 11 following implantation. Liver biopsies were sectioned and stained in order to highlight both the presence and function of impregnated cells in the liver tissue.RESULTSHaematoxylin and eosin-stained sections in GI and GII rats showed normal liver architecture while GIII rats showed presence of cell clusters inside the liver tissue and around the central veins. Cell clusters with blue cytoplasm were present in sections in GIII rats but absent in GI and GII rats, indicating the presence of injected differentiated human UCBMSCs. The anti-human insulin immunostaining of GIII rats showed clusters of cells within the liver parenchyma and around central veins, indicating that these cells were active and secreting insulin.CONCLUSIONUCBMSCs are proficient in differentiating into insulin-producing cells in vivo under specific conditions and, when transplanted into the liver of albino rats with STZ-induced diabetes mellitus, were able to secrete insulin and partially control the status of diabetes mellitus in rats. 相似文献
Dermonecrosis was induced in ICR mice by subcutaneous implantation of Staphylococcus aureus absorbed onto sterile cotton pellets. This model was used to assess the effects of marijuana smoke, marijuana placebo smoke and $DL9-tetrahydrocan-nabinol ($DL9-THC) on the local immune response to bacterial infection. Mice were exposed to 40 or 80 “puffs” of marijuana smoke, marijuana placebo smoke or air daily for 4 consecutive days. The estimated dose of $DL9THC per day generated from 40 or 80 puffs of marijuana smoke was 3.2 and 6.4 mg/kg, respectively. A group of sentinel (Shelf) control mice were included in each experiment. The necrotic index (NI) of mice exposed to 40 or 80 puffs of marijuana smoke were 67% and 44% of control, respectively. Air exposed mice showed a necrotic index comparable to the shelf control group. In chronically (60 days) exposed mice (80 puffs per day) the necrotic index was about 12% of control, while air-exposed mice were about 40% of control.
Placebo marijuana smoke exposed mice had a NI comparable to that of marijuana smoke exposed mice which suggested that the reduction in NI was unrelated to the pychomimetic component $DL9THC. To further explore which of the constituents of marijuana were responsible for the decreased NI, the ethanol extract from marijuana leaves was partioned between water (cannabinoid free) and chloroform (cannabinoid rich). Injection of the cannabinoid free fraction produced comparable decrease in the NI as observed with whole marijuana smoke, while the cannabinoid rich fraction produced no effect. $DL9THC at a dose of 10 mg/kg per day did not alter the NI. 相似文献
Eighty-eight adenovirus (Ad) isolates and associated clinical data were collected from walk-in patients with influenza-like illness in Egypt during routine influenza surveillance from 1999 through 2002. Respiratory Ad distributions are geographically variable, and serotype prevalence has not been previously characterized in this region. Serotype identity is clinically relevant because it predicts vaccine efficacy and correlates strongly with both clinical presentation and epidemiological pattern. Species and serotype identities were determined using several well-validated multiplex PCR protocols culled from the literature and supplemented with a few novel primer sets designed to identify rare types. The isolates included common species B1 serotypes (Ad3 and Ad7), common species C serotypes (Ad1, Ad2, and Ad5), the less common species B2 serotype Ad11, and three isolates of the rare species B1 serotype Ad16. Two isolates that appear to be variant Ad16 were also identified. Fifteen coinfections of multiple adenoviral types, primarily AdB/AdC and Ad3/Ad7 dual infections, were detected. The majority of these were verified using redundant PCR tests targeted at multiple genes. PCR is able to resolve coinfections, in contrast to traditional serum neutralization tests. PCR is also comparatively rapid and requires very little equipment. Application of the method allowed an inclusive determination of the serotypes found in the Egyptian respiratory sample set and demonstrated that coinfections are common and may play a previously unrecognized role in adenovirus pathogenesis, evolution, and epidemiology. In particular, coinfections may influence adenoviral evolution, as interserotypic recombination has been identified as a source of emerging strains. 相似文献
We evaluated a new immunoblot assay (Helicoblot 2.1) for Helicobacter pylori infection and CagA and VacA status by using serum samples from 222 patients. The test accurately detected H. pylori infection and VacA status, but improvements in the interpretation criteria are required before it can be recommended for determination of CagA status. 相似文献
OBJECTIVE: To evaluate the relationship between the serum concentration of TNFalphaRII and some adhesion molecules (including ICAM-1, VCAM-1, P-selectin and E-selectin) and coronary artery stenosis. DESIGN AND SETTING: Observational (cross-sectional) study in a university heart hospital in Tehran, Iran. PATIENTS: 81 patients with angiographically proven coronary artery disease were compared with 75 individuals who had undergone coronary angiography with no significant evidence of stenosis (control subjects). METHODS: Soluble adhesion molecules and TNFalphaRII were determined by enzyme-linked immunosorbent assay technique. sICAM-1 and sP-selectin values were significantly higher in patients with coronary artery disease than in control subjects (146 +/- 38 vs. 132 +/- 48 p < 0.04 and 275 +/- 107 vs. 241 +/- 104 ng/ml p < 0.04 respectively). Multiple logistic regression analysis showed sICAM-1 as an independent discriminating risk factor for coronary artery disease (p < 0.03). Prediction models that incorporated sICAM-1 in addition to other established coronary risk factors were significantly better at predicting risk than the models based on the other risk factors alone. Multiple regression analysis indicated that sP-selectin levels were greater in patients with single-vessel disease than in the respective normal (p < 0.01). CONCLUSIONS: Our findings suggest that sICAM-1 has an association with stable coronary artery disease and the evaluation of this marker may improve the coronary risk assessment in Iranian patients. 相似文献
Background: Vitamin B12 deficiency after gastric surgery for obesity is due to a failure of separation of vitamin B12 from protein foodstuffs and to a failure of absorption of crystalline vitamin B12 in the presence of intrinsic factor. The purpose of this study was to determine which of four oral doses of crystalline vitamin
B12 was most effective in treating vitamin B12 deficiency in 102 patients. Methods and Results: At time of entry into the study, the patients had a serum vitamin B12 < 100 pmol L −1, were 29.9 ± 21.7 months post-op, were 37 ± 8 years old and had a body mass index of 30 ± 6 kg m−2. Eight (8%) had had a vertical banded gastroplasty and 94 (92%) a gastric bypass. For the first 3 months all patients received
350 μg per day of crystalline vitamin B12 and all increased their serum vitamin B12 levels to over 100 pmol L−1. The patients were then assigned to receive for a further 3 month period one of four oral doses of crystalline vitamin B12-100 μg, 250 μg, 350 μg and 600 μg. Serum vitamin B12 levels were greater than 150 pmol L−1 after 6 months in 83.3% of patients who received 100 μg; 92.3% of patients who received 250 μg; 94.7% after 350 μg and 95.2%
after 600 μg (p%0.525). Conclusion: At least 350 μg per day is the appropriate oral dose of crystalline vitamin B12 after gastric surgery for obesity to correct low serum vitamin B12 levels in 95% of patients. 相似文献
2-benzoyl-3-phenylquinoxaline 1,4-dioxide (BPQ) and other substituted quinoxaline 1,4-dioxides (QdO) were tested for their
ability to inhibit the stimulations of ornithine decarboxylase (ODC) enzyme activity and DNA synthesis, two biochemical markers
linked to skin tumour promotion by ultraviolet B (UVB) radiation. Topical application of BPQ on the dorsal skin of hairless
mice was found to inhibit in a dose-dependent manner UVB-induced ODC activity and DNA synthesis. When applied 20 min before
UVB radiation, a dose of 17 mg BPQ applied in 0.4 ml of vehicle inhibited UVB-induced ODC activity and DNA synthesis by 95%
and 85%, respectively. This inhibitory effect is dependent on the time of administration of BPQ relative to UVB radiation,
with a generally greater inhibition observed when this compound is applied before rather than after UVB treatment. The inhibitory
abilities of the other QdO on the ODC and DNA responses induced by UVB radiation greatly varied and appear to be dependent
on the structure of the compounds and their metabolic activation in the skin following irradiation. The remarkable effectiveness
of BPQ against the ODC and DNA markers of UVB promotion is also observed following multiple applications of this agent. These
results suggest that QdO, in particular BPQ and certain derivatives of it, may be useful in protecting the skin against UVB-induced
skin damage. 相似文献