A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Recombinant tumor necrosis factor alpha does not inhibit the growth of African trypanosomes in axenic cultures

Mice whose tumor necrosis factor alpha (TNF-alpha) genes were disrupted developed higher levels of parasitemia than wild-type mice following infection with Trypanosoma congolense IL1180 or T. brucei brucei GUTat3.1, confirming the results of earlier studies. To determine whether TNF-alpha directly affects the growth of these and other bloodstream forms of African trypanosomes, we studied the effects of recombinant mouse, human, and bovine TNF-alpha on the growth of two isolates of T. congolense, IL1180 and IL3338, and two isolates of T. brucei brucei, GUTat3.1 and ILTat1.1, under axenic culture conditions. The preparations of recombinant TNF-alpha used were biologically active as determined by their capacity to kill L929 cells. Of five recombinant TNF-alpha lots tested, one lot of mouse TNF-alpha inhibited the growth of both isolates of T. brucei brucei and one lot of bovine TNF-alpha inhibited the growth of T. brucei brucei ILTat1.1 but only at very high concentrations and without causing detectable killing of the parasites. The other lots of mouse recombinant TNF-alpha, as well as human TNF-alpha, did not affect the growth of any of the test trypanosomes even at maximal concentrations that could be attained in the culture systems (3,000 to 15,000 U of TNF-alpha/ml of medium). These results suggest that exogenously added recombinant TNF-alpha generally does not inhibit the growth of African trypanosomes under the culture conditions we used. The impact of TNF-alpha on trypanosome parasitemia may be indirect, at least with respect to the four strains of trypanosomes reported here.     

Laparoscopic ovarian drilling for women with anovulatory polycystic ovarian syndrome: a district general hospital experience

This is a retrospective study involving 100 anovulatory women with polycystic ovarian syndrome (PCOS) who had laparoscopic ovarian drilling (LOD) between January 1995 and May 2002 at the Royal Berkshire Hospital, Reading, a large district general hospital (DGH). The aim was to evaluate the efficacy of LOD in the treatment of women with anovulatory PCOS in a DGH setting. We also looked at the factors predicting the clinical outcome to be able to counsel the patients pre-operatively. The study showed that the spontaneous pregnancy rate after LOD was 32.46%. A further 28.5% conceived after induction of ovulation with clomiphene citrate (CC) or purified follicular stimulating hormone (Metrodin HP), with a cumulative pregnancy rate of 74%. We did not find a significant difference in the luteinising hormone to follicular stimulating hormone (LH:FSH) ratio of greater than 2.5, LH level of greater than 10 IU/l, body mass index (BMI), age or duration of infertility between the group of women who conceived and those who failed to conceive, in response to LOD.     

The Cameriere,Haavikko, Demirjian,and Willems methods for the assessment of dental age in Croatian children

International Journal of Legal Medicine - This study aimed to evaluate the accuracy and precision of the Cameriere European formula, Demirjian, Haavikko, and Willems methods for estimating dental...     

Validation of the Italian,European, North German,Malaysian, and South African black formulas on Cameriere method using panoramic radiographs in Kenyan children

International Journal of Legal Medicine - This study aimed to validate the accuracy of five different formulas based on the Cameriere method for age estimation in Kenyan children. We analyzed...     

Studying host genetic background effects on multimorbidity of intestinal cancer development,type 2 diabetes and obesity in response to oral bacterial infection and high‐fat diet using the collaborative cross (CC) lines

BackgroundMultimorbidity of intestinal cancer (IC), type 2 diabetes (T2D) and obesity is a complex set of diseases, affected by environmental and genetic risk factors. High‐fat diet (HFD) and oral bacterial infection play important roles in the etiology of these diseases through inflammation and various biological mechanisms.MethodsTo study the complexity of this multimorbidity, we used the collaborative cross (CC) mouse genetics reference population. We aimed to study the multimorbidity of IC, T2D, and obesity using CC lines, measuring their responses to HFD and oral bacterial infection. The study used 63 mice of both sexes generated from two CC lines (IL557 and IL711). For 12 weeks, experimental mice were maintained on specific dietary regimes combined with co‐infection with oral bacteria Porphyromonas gingivalis and Fusobacterium nucleatum, while control groups were not infected. Body weight (BW) and results of a intraperitoneal glucose tolerance test (IPGTT) were recorded at the end of 12 weeks, after which length and size of the intestines were assessed for polyp counts.ResultsPolyp counts ranged between 2 and 10 per CC line. The combination of HFD and infection significantly reduced (P < .01) the colon polyp size of IL557 females to 2.5 cm², compared to the other groups. Comparing BW gain, IL557 males on HFD gained 18 g, while the females gained 10 g under the same conditions and showed the highest area under curve (AUC) values of 40 000‐45 000 (min mg/dL) in the IPGTT.ConclusionThe results show that mice from different genetic backgrounds respond differently to a high fat diet and oral infection in terms of polyp development and glucose tolerance, and this effect is gender related.