Evidence that [3H]-alpha,beta-methylene ATP may label an endothelial-derived cell line 5'-nucleotidase with high affinity.

1. In membranes prepared from a permanent cell line of endothelial origin (WEC cells), [3H]-alpha, beta-methylene ATP ([3H]-alpha, beta-meATP) labelled high (pKd = 9.5; Bmax = 3.75 pmol mg-1 protein) and low (pKd = 7.2; Bmax = 23.3 pmol mg-1 protein) affinity binding sites. The high affinity [3H]-alpha, beta-meATP binding sites in the WEC cell membranes could be selectively labelled with a low concentration of the radioligand (1 nM). In competition studies performed at a radioligand concentration of 1 nM, 88.6% of the sites possessed high affinity (pIC50 = 8.26) for alpha, beta-meATP. 2. The high affinity [3H]-alpha, beta-meATP binding sites appeared heterogeneous since in competition studies a number of nucleotide analogues (alpha, beta-meADP, ATP, ADP, AMP, GTP, GppNHp, GMP) and adenosine identified two populations of the sites labelled by 1 nM [3H]-alpha, beta-meATP. The proportion of sites with high affinity for these compounds was found to vary between 42 and 69%. 3. Approximately 60-69% of the binding sites labelled with 1 nM [3H]-alpha, beta-meATP possessed high affinity for alpha, beta-meADP (pIC50 = 8.87), AMP (pIC50 = 7.12), GMP (pIC50 = 7.34), UTP (pIC50 = 6.12), GTP (pIC50 = 7.59), GppNHp (pIC50 = 7.35) and adenosine (pIC50 = 5.45).(ABSTRACT TRUNCATED AT 250 WORDS)     

Analgesic profile of the sodium salt of pemedolac

Pemedolac Na, 1-ethyl-1,3,4,9-tetrahydro-4-(phenylmethyl)-pyrano [3,4-b] indole-1-acetic acid sodium salt, exhibited equipotent analgesic effects after oral, iv, and im administration, suggesting that it is well absorbed. In mouse writhing models, the ED₅₀ values ranged from 0.3 mg (0.81 μmol)/kg (vs. acetylcholine) to 4.3 mg (11.6 μmol)/kg (vs. paraphenylbenzoquinone [PBQ]). In the rat Randall-Selitto model, the ED₅₀ o the compound was approximately 0.001 mg (2.7 nmol)/kg, with a flat dose response curve. The peak effects lasted for 7–9 h, 10–18 h, and 5 h following oral, im, and iv injections, respectively. Intracerebroventricular (i.c.v.) injections of pemedolac Na inhibited the PBQ-induced writing in mice with an ED₅₀ of 43.5 μg (0.12 μmol)/mouse, and this effect was not antagonized by naloxone. It was inactive in the hot plate and tail flick tests, demonstrating that pemedolac Na does not act via an opiate mechanism. These results indicate that pemedolac Na is a viable parenteral and oral analgesic, typified by high analgesic potency, a rapid onset and long duration of action, and an extremely wide safety index. © Wiley-Liss, Inc.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Impact of clinical history on fracture detection with radiography

The effect of knowledge of localizing symptoms and signs in the detection of fractures was studied. Forty radiographs of the extremities were examined twice by seven radiologists; the sessions were separated by 4 months. In 26 cases, a subtle fracture was present; 14 cases were normal. In half of the cases at each session, the precise location of pain, tenderness, or swelling was provided. The observer was asked to determine if the case was normal or abnormal (provide the exact location of the fracture) and to indicate the degree of confidence in the diagnosis. Responses were converted to a numeric scale for analysis. Analysis of receiver operator characteristic parameters indicates that clues regarding location of trauma facilitate detection of fractures. The improvement is based largely on an increased true-positive rate without an increased false-positive rate, regardless of the decision criteria of the radiologist (overall willingness to "overread" or "underread"). This has direct clinical applicability and reinforces the plea of radiologists for precise clinical information.     

Normal and borderline ambulatory arterial pressures. A new method for establishing reference values

Ambulatory arterial pressures, both systolic (SAP) and diastolic (DAP), together with heart rate were measured every 15 minutes during 24 hours, using a Spacelabs 5200 apparatus, in 168 male subjects of mean age 21 +/- 1 years. According to the WHO criteria, 72 subjects had normal arterial pressure (clinical DAP less than or equal to 90 mmHg, clinical SAP less than or equal to 140 mmHg), and 86 subjects had untreated borderline arterial hypertension (abnormal clinical pressures, with clinical DAP less than or equal to 95 mmHg and clinical SAP less than or equal to 160 mmHg). On the basis of the WHO criteria, a sizeable part of pressure profiles in the normal and hypertensive groups overlapped. The Mc Queen method, derived from cluster analysis, considerably reduces this overlap. The method defines and objective criterion which enables the subjects to be reclassified in cases where clinical and ambulatory pressures "contradict each other". Such reclassification applied in about 20% of our subjects. This leads to a new definition of reference groups based on both clinical pressure and ambulatory pressure profile. The WHO criteria remain the basis for this classification. The Mc Queen method may be used to define normal and borderline arterial pressure profiles in male and female subjects of different age-groups.     

Effect of Histamine Receptor Blocking on Human Antibody-dependent Cell-mediated Cytotoxicity

The effect of H1 and H2 receptor-blocking agents on antibody-dependent cell-mediated cytotoxicity (ADCC) was studied. The H1 receptor-blocker clemastinum and the H2 receptor blocker cimetidine dose-dependently inhibited the antibody-dependent cytotoxic activity of normal human peripheral blood mononuclear cells on chicken erythrocytes. The inhibition cannot be explained either by a direct toxic effect on effector cells or by blocking of Fc receptors. The possible involvement of histamine receptor-bearing effector cells in human ADCC is suggested.     

Mechanical Analysis of Atherosclerotic Plaques Based on Optical Coherence Tomography

Finite element analysis is a powerful tool for investigating the biomechanics of atherosclerosis and has thereby provided an improved understanding of acute myocardial infarction. Structural analysis of arterial walls is traditionally performed using geometry contours derived from histology. In this paper we demonstrate the first use of a new imaging technique, optical coherence tomography (OCT), as a basis for finite element analysis. There are two primary benefits of OCT relative to histology: 1) imaging is performed without excessive tissue handling, providing a more realistic geometry than histology and avoiding structural artifacts common to histologic processing, and 2) OCT imaging can be performed in vivo, making it possible to study disease progression and the effect of therapeutic treatments in animal models and living patients. Patterns of mechanical stress and strain distributions computed from finite element analysis based on OCT were compared with those from modeling based on "gold standard" histology. Our results indicate that vascular structure and composition determined by OCT provides an adequate basis for investigating the biomechanical factors relevant to atherosclerosis and acute myocardial infarction.     

Comparison of antiinflammatory and antiallergic drugs in the melittin- and D49 PLA2-induced mouse paw edema models

Melittin (MLT) (10 g/paw) and D49 (0.4 g/paw) were injected into the hind paw of male CD-1 mice and elicited 70–80% of maximal paw edema responses at 60 and 30 min after injection, respectively. D49 paw edema was significantly inhibited by anti-histamine/serotonin agents, a PAF antagonist, a PLA₂ inhibitor, and some but not all 5-LO and CO inhibitors, indicating that this edema is produced by several classes of inflammatory mediators with mast cell degranulation apparently playing a major role. In contrast, MLT paw edema was not inhibited effectively using the same pharmacological agents except theophylline, suggesting it was elicited via a different sequence of inflammatory events. In summary, D49 and MLT paw edema models were found to be ineffective models to identify experimental PLA₂ compounds in our laboratory.