Blood–Brain Barrier Function and Biomarkers of Central Nervous System Injury in Rickettsial versus Other Neurological Infections in Laos

Blood–brain barrier (BBB) function and cerebrospinal fluid (CSF) biomarkers were measured in patients admitted to hospital with severe neurological infections in the Lao People''s Democratic Republic (N = 66), including bacterial meningitis (BM; N = 9) or tuberculosis meningitis (TBM; N = 11), Japanese encephalitis virus (JEV; N = 25), and rickettsial infections (N = 21) including murine and scrub typhus patients. The albumin index (AI) and glial fibrillary acidic protein (GFAP) levels were significantly higher in BM and TBM than other diseases but were also raised in individual rickettsial patients. Total tau protein was significantly raised in the CSF of JEV patients. No differences were found between clinical or neurological symptoms, AI, or biomarker levels that allowed distinction between severe neurological involvement by Orientia tsutsugamushi compared with Rickettsia species.Central nervous system (CNS) infections are caused by a range of different pathogens and a major cause of morbidity and mortality worldwide.^1,2 Orientia tsutsugamushi and Rickettsia spp. infections have recently been identified as a major cause of CNS disease in Lao People''s Democratic Republic (Laos) in a large prospective study³ where 9% of all CNS infections were caused by O. tsutsugamushi, Rickettsia spp., or Leptospira spp.⁴ Differentiating these organisms in scrub and murine typhus patients from other causes of meningoencephalitis such as bacterial or tuberculous meningitis is diagnostically challenging. Neurological manifestations of severe typhus occur in up to 10% of cases, with headache, photophobia and meningeal symptoms, decreased consciousness, or even death.^4–8 Japanese encephalitis virus (JEV) is also an important cause of CNS disease.⁹ Neuropathological data from autopsy cases of rickettsial and JEV deaths are limited,¹⁰ so studying the cerebrospinal fluid (CSF) of living patients may help diagnosis and our understanding of the pathophysiology of CNS rickettsial, as opposed to other, infections.^11,12This study compared blood–brain barrier (BBB) function and CSF biomarkers of cellular activation and injury in patients with severe neurological infections from Laos and explored their relationship with clinical presentation and laboratory findings. Patients (N = 66) were part of a hospital-based prospective study of CNS infections and included if matching samples of admission plasma and CSF were available. Ethical approval was granted by OXTREC (015-02, University of Oxford, United Kingdom) and the Faculty of Medical Sciences Committee (University of Health Sciences, Lao PDR).³ The following groups were included: bacterial meningitis (BM: N = 9; Streptococcus pneumonia [N = 5], Neisseria meningitides [N = 2], S. suis [N = 1], S. viridans [N = 1]); Mycobacterium tuberculosis meningitis (TBM, N = 11); Japanese B encephalitis virus (JEV, N = 25), and rickettsial infections (N = 21): O. tsutsugamushi (N = 11), Rickettsia typhi (N = 7), and (N = 3) other Rickettsia spp. Bacterial molecular diagnostics and Rickettsia culture and typing were performed as described.³ TBM was defined as CSF culture positivity for M. tuberculosis on Lowenstein–Jensen medium with subsequent molecular confirmation (GenoType MTBDRplus version 2; Hain Lifescience, Nehren, Germany). JEV cases were confirmed by enzyme-linked immunosorbent assay (ELISA) on CSF using the Japanese encephalitis Dengue IgM Combo ELISA test (E-JED01C, Panbio, Japan) or by pan-flavivirus polymerase chain reaction (PCR) and sequencing (N = 1; Macrogene, Korea; NCBI/Blastn: Identity 97% to {"type":"entrez-nucleotide","attrs":{"text":"GQ902059.1","term_id":"307826665"}}GQ902059.1, E-value: 8e-79, coverage: 100%, c782-PF3PF2b:GGTTCATGTGGCTGGGAGCACGGTACCTAGAGTTTGAAGCCCTAGGATTTCTAAATGAAGACCATTGGCTGAGCCGAGAGAATTCAGGAGGCGGGGTGGAAGGTTCAGGCGTCCAAAAGCTGGGATACATCCTCCGTGACATTGCAGGGAAGCAAGGAGGAAAAATGTATGCCGATGA).¹³ Changes in BBB function were assessed using the albumin index (AI; [AI = (CSF/plasma albumin)× 10³]) to determine leakage across the BBB.⁹ Plasma and CSF (1:2,000 dilution) were tested using human plasma albumin ELISA (Assaypro, St. Charles, MO) and CSF albumin ELISA kits (Abnova, Taipei City, Taiwan), respectively. Other biomarkers were measured using commercial ELISA kits according to manufacturer''s instructions to assess the astrocyte marker glial fibrillary acidic protein (GFAP; BioVendor, Brno, Czech Republic) and S100b for astroglial cells (BioVendor), neuron-specific enolase (NSE; USCN, Hubei, China), and total tau protein for axonal/neuronal damage (Invitrogen, Carlsbad, CA).¹² CSF samples were used undiluted (S100b, GFAP) or diluted (tau 1:2; NSE 1:10). Optical density values at 450 nm were determined by spectrophotometer (Multiskan Go; Thermo scientific, Waltham, MA), and the albumin/biomarker concentration was calculated from standard curves. Data were summarized using medians (interquartile range, [IQR]) or frequencies (%). Pairwise associations between AI and biomarker levels with demographics, clinical signs and symptoms, severity and outcome measures, and laboratory measures were assessed using Kendall''s rank correlation coefficient for continuous variables and the Mann–Whitney U test for categorical variables. Statistical analyses were done using Stata v12.0 (StataCorp LP, College Station, TX).The demographics, clinical, and laboratory findings are summarized in 3

Table 1

Demographic and clinical details, laboratory findings, AI, and biomarker levels by disease group

Cross-species transmission of poultry pathogens in backyard farms: ducks as carriers of chicken viruses

ABSTRACT

In backyard farms of Lao People’s Democratic Republic, mixed-species rearing of poultry is a breeding-ground for cross-species transmission. Here, the epidemiology of viruses circulating among backyard poultry in Vientiane Province was assessed to guide future control strategies. Oral/tracheal and cloacal swabs, collected from 605 poultry (308 ducks, 297 chickens) between 2011 and 2015, were screened by PCR for Newcastle disease virus (NDV), coronavirus (CoV) and chicken anaemia virus (CAV). Chicken sera were screened for anti-NDV antibodies by ELISA. Statistical and phylogenetic analyses revealed transmission patterns and relationships.

Closely related strains co-circulated in chickens and ducks. While CoV RNA was detected in oral/tracheal swabs of 9.3% of the chickens and 2.4% of the ducks, rates were higher in faecal swabs of both species (27.3% and 48.2%). RNA of infectious bronchitis virus (IBV) and duck CoV was found in faecal swabs of chickens (19.7% and 7.1%) and ducks (4.1% and 44.1%). Moreover, DNA of the generally chicken-specific CAV was detected in oral/tracheal swabs of chickens (18.1%) and, sporadically, of ducks (2.4%). Despite serological evidence of NDV circulation or vaccination (86.9%), NDV RNA was not detected. We found a high prevalence and indication for cross-species transmission of different CoV strains in backyard poultry. Interestingly, ducks served as biological, or at least mechanical, carriers of viral strains closely related not only to IBV, but also to CAV. Bird containment and poultry species separation could be first steps to avoid cross-species transmission and emergence of novel strains with broad host range and enhanced pathogenicity.

RESEARCH HIGHLIGHTS

• High rates of avian viruses were detected by PCR in backyard poultry from Lao PDR.

• Diverse coronavirus and chicken anemia virus strains co-circulated.

• Phylogenetic analyses suggested virus transmission between chickens and ducks.

• Serological evidence of Newcastle disease was found, but viral RNA was not detected.

     

Effect of thrombomodulin on the development of monocrotaline-induced pulmonary hypertension

Purpose

The purpose of the present study was to investigate whether thrombomodulin (TM) prevents the development of pulmonary hypertension (PH) in monocrotaline (MCT)-injected rats.

Methods

Human recombinant TM (3 mg/kg/2 days) or saline were given to MCT-injected male Sprague–Dawley rats for 19 (n = 14) or 29 (n = 11) days. Control rats (n = 6) were run for 19 days. The mean pulmonary artery pressure (mPAP), right ventricular hypertrophy (RVH), percentages of muscularized peripheral arteries (%muscularization), and medial wall thickness of small muscular arteries (%MWT) were measured. To determine inflammatory and coagulation responses, broncho-alveolar lavage fluid (BALF) was analyzed in another set of rats (n = 29). Western blotting for endothelial nitric oxide synthase (eNOS) and phosphorylated eNOS (peNOS) in the lung tissue was performed in separate rats (n = 13). Survival was determined in 60 rats.

Results

MCT increased mPAP, RVH, %muscularization, and %MWT. TM treatment significantly reduced mPAP, %muscularization, and %MWT in peripheral arteries with an external diameter of 50–100 μm in 19 days after MCT injection, but the effect was lost after 29 days. MCT increased the levels of tumor necrosis factor alpha, monocyte chemoattractant protein-1, and thrombin-antithrombin complex in BALF. Expression of eNOS increased in MCT rats, while peNOS decreased. The relative amount of peNOS to total eNOS increased in MCT/TM rats compared to MCT/Vehicle rats. A Kaplan–Meier survival curve showed no difference with and without TM.

Conclusion

Although the administration of TM might slightly delay the progression of MCT-induced PH, the physiological significance for treatment is limited, since the survival rate was not improved.     

Enhanced Determination of Streptococcus pneumoniae Serotypes Associated with Invasive Disease in Laos by Using a Real-Time Polymerase Chain Reaction Serotyping Assay with Cerebrospinal Fluid

A prospective hospital-based study was undertaken to define the incidence of invasive pneumococcal disease (IPD) and circulating serotypes in Laos. Of 10,799 patients with hemocultures and 353 patients with cerebrospinal fluid samples, 0.21% and 5.4%, respectively, were positive for Streptococcus pneumoniae, giving a total of 35 IPD patients. We developed a real-time polymerase chain reaction to detect serotypes represented in the 13-valent pneumococcal vaccine. A blinded evaluation comparing serotype as defined by the Quellung reaction versus the polymerase chain reaction demonstrated 100% concordance. The most frequent serotype (n = 33 patients) was 1 (n = 6), followed by serotypes 5, 6A/B/C, 14, and 23F. Serotypes represented in the 7-valent polysaccharide-protein conjugate vaccine (PCV-7) infected 39% of patients, with 73% coverage for the PCV-10 and PCV-13 vaccines. Although the sample size is small, these data suggest that the PCV-7 vaccine may have relatively low efficacy in Laos. Further studies are urgently needed to guide pneumococcal vaccine policy in Laos.