A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Academic achievement and metabolic control in adolescents with type 1 diabetes

Management of type 1 diabetes in adolescence is a complex task requiring self-control within individual and interpersonal domains. This is similarly requisite for academic achievement. Grade point average (GPA) was examined as a barometer of diabetes management reflective of self-control in a challenging daily context. Adolescents with type 1 diabetes (n = 172) completed questionnaires on self-control, self-efficacy, parent/peer relationships, and adherence, while mothers reported GPA. Self-control, self-efficacy, and parent/peer relationships predicted GPA, adherence and HbA1c. GPA predicted HbA1c above and beyond adherence and self-control predictors. GPA may be a valuable indicator of individual and interpersonal self-control processes required for diabetes management.     

Assessing rheumatologists’ attitudes and utilization of classification criteria for ankylosing spondylitis and axial spondyloarthritis: a global effort

Clinical Rheumatology - This study aims to assess rheumatologists’ perceptions, utilization patterns, and attitudes towards the modified New York (mNY) criteria for ankylosing spondylitis...     

Evolution and diversity of copy number variation in the great ape lineage

Copy number variation (CNV) contributes to disease and has restructured the genomes of great apes. The diversity and rate of this process, however, have not been extensively explored among great ape lineages. We analyzed 97 deeply sequenced great ape and human genomes and estimate 16% (469 Mb) of the hominid genome has been affected by recent CNV. We identify a comprehensive set of fixed gene deletions (n = 340) and duplications (n = 405) as well as >13.5 Mb of sequence that has been specifically lost on the human lineage. We compared the diversity and rates of copy number and single nucleotide variation across the hominid phylogeny. We find that CNV diversity partially correlates with single nucleotide diversity (r² = 0.5) and recapitulates the phylogeny of apes with few exceptions. Duplications significantly outpace deletions (2.8-fold). The load of segregating duplications remains significantly higher in bonobos, Western chimpanzees, and Sumatran orangutans—populations that have experienced recent genetic bottlenecks (P = 0.0014, 0.02, and 0.0088, respectively). The rate of fixed deletion has been more clocklike with the exception of the chimpanzee lineage, where we observe a twofold increase in the chimpanzee–bonobo ancestor (P = 4.79 × 10⁻⁹) and increased deletion load among Western chimpanzees (P = 0.002). The latter includes the first genomic disorder in a chimpanzee with features resembling Smith-Magenis syndrome mediated by a chimpanzee-specific increase in segmental duplication complexity. We hypothesize that demographic effects, such as bottlenecks, have contributed to larger and more gene-rich segments being deleted in the chimpanzee lineage and that this effect, more generally, may account for episodic bursts in CNV during hominid evolution.Sequence and assembly of great ape reference genomes have consistently revealed that copy number variation (CNV) affects more base pairs than single nucleotide variation (SNV) (Cheng et al. 2005; The Chimpanzee Sequencing and Analysis Consortium 2005; Locke et al. 2011). Segmental duplications, in particular, have disproportionately affected the African great ape (human, chimpanzee, and gorilla) lineages, where they appear to have accumulated at an accelerated rate (Cheng et al. 2005; Marques-Bonet et al. 2009). This has led to speculation that differences in fixation and copy number polymorphism may have contributed to the phenotypic “plasticity” and species-specific differences between humans and great apes (Olson 1999; Varki et al. 2008). While there is some evidence that fixed deletions and duplications contribute to morphological differences between humans and great apes (McLean et al. 2011; Charrier et al. 2012; Dennis et al. 2012), a comprehensive assessment of these differences at the level of the genome has not yet been performed. Previous studies of CNV have been predominated by array comparative genomic hybridization (CGH) experiments (Fortna et al. 2004; Perry et al. 2006; Dumas et al. 2007; Gazave et al. 2011; Locke et al. 2011), which provide limited size resolution, are imprecise in absolute copy number differences, and are biased by probes derived from the human reference genome. Comparisons of reference genomes have been complicated by assessments of a single individual and distinguishing CNVs from assembly errors (The Chimpanzee Sequencing and Analysis Consortium 2005; Locke et al. 2011; Ventura et al. 2011; Prüfer et al. 2012). Here, we compare the evolution and diversity of deletions, duplications, and SNVs in 97 great ape individuals sequenced to high coverage (median ∼25×) (Prado-Martinez et al. 2013). The set includes multiple individuals from the four great ape genera, including Bornean and Sumatran orangutans, each of the four recognized chimpanzee subspecies, bonobos, and both Eastern and Western gorillas, in addition to 10 diverse humans and a high-coverage archaic Denisovan individual. This data set provides unprecedented genome-wide resolution to interrogate multiple forms of genetic variation and a unique opportunity to directly compare mutational processes and patterns of diversity in great apes.     

Monocyte activity is linked with abdominal aortic aneurysm diameter

Background

Systemic inflammation and increased matrix metalloproteinase (MMP) cause elastin degradation leading to abdominal aortic aneurysm (AAA) expansion. Several prospective studies report that statin therapy can reduce AAA expansion through anti-inflammation. We hypothesize that monocyte activity plays a pivotal role in this AAA development and this study examines patient peripheral blood monocyte cell adhesion, transendothelial migration, and MMP concentrations between AAA and non-AAA patients.

Materials and methods

Peripheral blood was collected and monocytes isolated from control (n = 15) and AAA (n = 13) patients. Monocyte adhesion, transmigration, and permeability assays were assessed. Luminex assays determined MMP-9 and tissue inhibitor of metalloproteinase-4 (TIMP-4) concentrations from cell culture supernatant and patient serum.

Results

AAA patient monocytes showed increased adhesion to the endothelium relative fluorescence units (RFU, 0.33 ± 0.17) versus controls (RFU, 0.13 ± 0.04; P = 0.005). Monocyte transmigration was also increased in AAA patients (RFU, 0.33 ± 0.11) compared with controls (RFU, 0.25 ± 0.04, P = 0.01). Greater numbers of adhesive (R² = 0.66) and transmigratory (R² = 0.86) monocytes were directly proportional to the AAA diameter. Significantly higher serum levels of MMP-9 (2149.14 ± 947 pg/mL) were found in AAA patients compared with controls (1189.2 ± 293; P = 0.01). TIMP-4 concentrations were significantly lower in AAA patients (826.7 ± 100 pg/mL) compared with controls (1233 ± 222 pg/mL; P = 0.02). Cell culture supernatant concentrations of MMP and TIMP from cocultures were higher than monocyte-only cultures.

Conclusions

Monocytes from AAA patients have greater adhesion and transmigration through the endothelium in vitro, leading to elevated MMP-9 levels and the appropriate decrease in TIMP-4 levels. The ability to modulate monocyte activity may lead to novel medical therapies to decrease AAA expansion.     

Variations in acute multifocal histoplasmic choroiditis in the primate.

Experimental histoplasmic choroiditis was produced in primates by intracarotid injections of living H. capsulatum organisms. The severity of the choroiditis varied with inoculum size, as well as with site of injection (common carotid vs. internal carotid artery). A reproducible model of histoplasmic choroiditis in primates was produced with an internal carotid injection of 5,000 to 10,000 organisms/lb. The clinical and histopathological course of this acute choroiditis over the first 30 days is presented.